methods for modifying rna splicing

专利摘要:
An intronic splicing modifier recognition element (iREMS) is described herein which can be recognized by a small molecule splicing modifying compound of Formula (I) provided in the present, or a form of the same, where W, X, A and B are as defined herein. In one aspect, methods for modifying RNA splicing are described in order to modulate the amount of a gene product, in which a transcript of the precursor RNA, transcribed from the gene containing an intronic REMS, is modified using a modifying compound of Formula (I) splicing. In another aspect, methods for modifying RNA splicing are described in order to modulate the amount of an RNA transcript or protein product encoded by a gene, wherein a transcript of the preceding RNA transcript of the gene is modified to comprise an intronic REMS using a splicing modifier compound of Formula (I).
公开号:BR112019026508A2
申请号:R112019026508-2
申请日:2018-06-13
公开日:2020-07-14
发明作者:Amal Dakka；Anuradha Bhattacharyya；Christopher Trotta；Kari Wiedinger；Kerstin Effenberger；Minakshi B. Jani；Nikolai Naryshkin；Vijayalakshmi Gabbeta；Wencheng Li
申请人:Ptc Therapeutics, Inc.；
IPC主号:

专利说明:

[0001] [0001] This patent application claims its priority benefit to Provisional U.S. Patent Application No. 62/519 226, filed on June 14, 2017, the contents of which are incorporated herein, in their entirety, by reference in this patent application.
[0002] [0002] This patent application incorporates a Sequence Listing by reference, submitted together with this patent application in a text file in ASCII format entitled “10589- 277-228 Sequence Listing.txt”, created on June 13 and with
[0003] [0003] In one aspect, a splicing modifier recognition element (REMS) is described in an intron (ie an "intronic REMS" or "iREMS") that can be recognized as a 5 "splice site by Ul snRNP and / or other components of the pre-mRNA splicing (recomposition) machinery in the presence of a small splicing-modifying molecule, in which gene expression is modified by inducing alternative splicing of intronic exons (iExons) in the transcribed RNA In another aspect, methods are described to modulate the quantity of a gene product, in which a transcript of the precursor RNA, transcribed from the gene, contains an intronic REMS, a branch point and a splice site 3 ", and the methods use a small molecule compound described herein to induce alternative splicing of iExons. More particularly, methods are described for modulating the amount of an RNA transcript or protein product encoded by a gene via alternative iExons splicing, wherein a precursor RNA transcript, transcribed from the gene, comprises an endogenous or non-endogenous intronic REMS , and the methods use a compound described herein to induce alternative splicing of iExons. In another aspect, artificial gene constructs are provided comprising an intronic REMS (including an endogenous or non-endogenous intronic REMS), and uses of these artificial gene constructs to modulate protein production via alternative iExons splicing in the presence of a splicing modifier compound. small molecule. In another aspect, methods are provided to alter genes to comprise a non-endogenous intronic REMS, and the use of a small molecule compound described here to induce alternative splicing of iExons, subsequently modulating the amount and modifying the type of protein produced from of transcripts of such non-endogenous genes. Fundamentals of the invention
[0004] [0004] Diseases associated with the expression in an abnormal amount (lesser or greater than normally required) of a gene product or an abnormal gene product (eg, where the production of an abnormal RNA or protein transcript) causes a disease) are often treated with a focus on affecting abnormal protein expression. However, the underlying cause of a disease or disorder can be affected by targeting components of the splicing process responsible for the production of the abnormal RNA, before the abnormal protein or abnormal amount of protein is expressed, using a small molecule, preventing or thereby improving the disease or disorder caused by the expression of the abnormal gene product or the abnormal amount of the gene product. Thus, there is a need for methods that modulate the expression of abnormal RNA transcripts encoded by certain genes, using small molecules, to prevent or treat diseases associated with the expression of abnormal RNA transcripts, or associated proteins, or associated with the expression of an abnormal amount of RNA transcripts or associated proteins. Summary of the invention
[0005] [0005] In one aspect, a splicing modifier recognition element (also known as “REMS”) present in an intron (ie an “intronic REMS” or “iREMS”) and capable of being recognized by Ul is provided. snRNP and / or other components of the pre-mRNA splicing machinery in the presence of a small splicing modifying molecule, by which elements of the splicing reaction are affected as described in more detail below. In a specific aspect, the intronic REMS comprises the nucleotide sequence GAgurngn found in an intronic sequence at the RNA level, where r is A or G (that is, a purine nucleotide carrying adenine or guanine) and n is any nucleotide. In another specific aspect, the intronic REMS comprises the nucleotide sequence GAguragu found in an intronic sequence at the RNA level, where r is adenine or guanine. In a specific aspect, the intronic REMS comprises the nucleotide sequence NNGAgurngn (SEQ ID NO: 1) found in an intronic sequence at the RNA level, where r is A or G (ie, a purine nucleotide carrying adenine or guanine ) en or N is any nucleotide. In another specific aspect, the intronic REMS comprises the nucleotide sequence NNGAguragu (SEQ ID NO: 2) found in an intronic sequence at the RNA level, where r is adenine or guanine and N is any nucleotide. In one or more of the specific aspects defined above, N is adenine or guanine.
[0006] [0006] In another aspect, in addition to the iREMS sequence, the intron of an RNA transcript comprises a branching point and a functional 3 'splice site. One aspect described here refers to iExons, in which the RNA transcript comprises two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which the intron comprises 5 "to 3 'direction: a first 5' splice site, a first branching point, a first 3 'splice site (also referred to as iExon 3' splice site), an intronic REMS sequence, a second branching point and a second 3 'splice site (see, for example, Figure 1A) .In this aspect, in the presence of a compound described here, the intronic sequence of REMS acts as a 5' splice site and will be spliced with second 3 'splice site, causing the NNGA nucleotides of the iREMS sequence and the intronic nucleotides downstream of the first 3' splice site to be retained and recomposed as an intronic exon to provide a non-wild type mRNA. described refers to eExons (extended exons), in which the RNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 "to 3 direction ': an intronic REMS sequence, a branch point and a splice site 3' (see, for example, Figures 1B and 1C: Exon le and Exon 2e, respectively). In that respect, in the presence of a compound described herein, the splice site 5 'upstream of the splice site of iREMS is not spliced with the splice site 3' downstream. Instead, in the presence of a compound described herein, the iREMS sequence, in the presence of the downstream branch point, is spliced as a downstream 3 'splice site. In this respect, the exon is extended from the 5 "splice site, by one or more nucleotides included in the mRNA transcript downstream of the annotated 5 'splice site, to the iREMS splice site.
[0007] [0007] In certain respects, one or more elements of the sequence necessary to form an iExon may be present endogenously or non-endogenously, in which the elements of the sequence are selected from the group consisting of an intronic REMS, a branch and a 3 "splice site of the iExon. In other respects, one or more additional elements of the sequence needed to form an iExon may be present endogenously or non-endogenously, where the elements of the sequence are selected from the group that consists of a 5 'splice site, a second branching point and a second exon 3' splice site. In another aspect of an iExon, the sequence elements necessary to form an iExon include a splice 3 site sequence 'upstream of iExon, an intronic REMS sequence, a branch point sequence downstream and a splice site sequence 3' downstream. In another aspect, in which an eExon (extended exon) is formed, the elements Sequence elements needed to form an eExon include an intronic REMS sequence, a downstream branch point sequence, and a 3 'splice site sequence
[0008] [0008] In Figure 1A, the intronic REMS is located at Intron 1 downstream of a 5 'splice site of Exon 1 (ie, a 5' splice site at the 3 'end of Exon 1), a first sequence of branch point (BP) and a first iExon splice site sequence 3 'and upstream of a second branch point sequence and a second Exon 2 splice site sequence in an RNA transcript (i.e. , a precursor mRNA). In the presence of a small molecule splicing modifier compound described here, the iREMS sequence acts as a 5 'splice site, whereby the nucleotides between the 5' splice site of Exon 1 and the first 3 'splice site iExon are removed between Exon 1 and a nascent intronic exon, and the nucleotides between the intronic REMS and the second splice 3 'site are removed between iExon la and Exon 2, thus allowing Exon 2 and the intron portion comprising the nucleotides of the first splice site 3 'up to and including NNGA of the intronic REMS are joined, thereby introducing an iExon la derived from the intron and generating a non-wild-type mMRNA. In certain aspects of Figure 1A, one or more elements necessary to induce splicing may be present by endogenous means or introduced and may be in any configuration capable of being recognized by the splicing machinery as an "exon", in which one or more of the elements are selected from the group consisting of the intronic REMS, the first branching point, the first 3 'splice site, the second branching point and the second 3' splice site. Although illustrated for Intron 1, where the configuration in this case results in a non-wild type iExon, this concept can generally be applied to any other intron in an RNA transcript.
[0009] [0009] In Figure 1B, the intronic REMS is located at an intron of an RNA transcript downstream of a 5 'splice site of Exon 1 (ie, a 5' splice site at the 3 'end of Exon 1) and upstream of a branch point sequence of Intron 1 and a splice site sequence 3 'of Exon 2 (i.e., a splice site 3' at the 5 'end of Exon 2). In the presence of a small molecule splicing modifier compound described herein, the nucleotides between the 5 'splice site of Exon 1 and the intronic REMS are retained and those between the intronic REMS and the 3' splice site sequence of Intron 1 (except for the intronic REMS NNGA nucleotides) are removed, allowing Exon ll and the intron portion comprising nucleotides from those adjacent to the 5 'splice site of Exon 1 to and including intronic REMS NNGA and Exon 2 nucleotides to be United. Although illustrated for Exon 1 as an example of a particular configuration, this concept can generally be applied to any other exon that has another exon downstream. The elements necessary to induce the splicing of an eExon can be present in any configuration capable of being recognized by the splicing machinery as an "exon". Thus, in the presence of a splicing-modifying compound, the spliceosome recognizes the elements as exonic limits for removing interfering intronic nucleotides between these two limits. The configuration in this case results in an eExon, with an exon extension upstream at its 3 'end.
[0010] [0010] In Figure 1C, the intronic REMS is located at Intron 2 downstream of a splice site 5 'of Exon 2 (ie, a splice site 5' at the 3 'end of Exon 2) and downstream of a an intron 2 branch point sequence and a 3 'splice site sequence from Exon 3 (i.e., a 3' splice site at the 5 "end of Exon 3) in an RNA transcript. In the presence of a modifying compound of small molecule splicing described here, the nucleotides between the intronic REMS and the Exon 3 splice site sequence 3 'are removed, allowing Exon 3 and the intron portion comprising nucleotides from those adjacent to the 5' splice site Exon 2 up to and including NNGA from the intronic REMS are joined In this example, the endogenous splicing reaction between Exon 1 and Exon 2 is not affected by the presence of a compound described here, resulting in the complete removal of Intron 1. Although illustrated for Exon 2, this concept can generally be applied to any other exon nascent, that is, an exon that is located between at least one exon downstream and an exon upstream of the same pre-mRNA transcript.
[0011] [0011] In this specification, a "5'exon splice site" or similar refers to a 5 'splice site at the 3' end of the exon upstream of the iREMS sequence, while an "exon 3 splice site" 'exon' or the like refers to a splice site 3 'at the 5' end of the exon downstream of the iREMS sequence.
[0012] [0012] In the presence of a small molecule splicing modifier compound described here, the nucleotides of iREMS retained in the formation of an iExon or eExon are selected from the group consisting of ANGA, CNGA, GNGA, UNGA, NAGA, NCGA, NGGA, NUGA, AAGA, ACGA, AGGA, AUGA, CAGA, CCGA, CGGA, CUGA, GAGA, GCGA, GGGA, GUGA, UAGA, UCGA, UGGA and UUGA. The inclusion of an iExon or the formation of an eExon can result in an RNA transcript with an altered or broken open reading phase due to the inclusion of a sequence maintaining the phase, frameshift phase, premature stop codon, or internal insertion or deletion (as a result of mutually exclusive alternative splicing) within the open reading phase. In other aspects resulting from alternative non-mutually exclusive splicing, the inclusion of an iExon or the formation of an eExon may result in the mature mRNA having a functional open reading frame, producing a new protein that may or may not be functional or may be unstable and rapidly degraded. The low abundance of RNA transcripts with an altered or truncated open reading phase is expected and these transcripts can be substrates for nonsense-mediated decay, nonstop-mediated decay, no-go decay, translation-dependent decay, removal of the iExon-mediated cap (iExon-mediated decapping), alternative formation of the 3 'end and polyadenylation and thus there is little abundance. Any transcripts of RNA modified by alternative splicing mediated by intronic REMS may also have altered stability, altered intracellular transport, altered efficiency of 3 'end formation and altered translation efficiency. In aspects described below, the term "sequence maintaining phase" refers to the inclusion of a sequence that alters the open reading phase, but maintains the nucleotide cracks between the start and stop codons in the mature mRNA. In aspects described below, the term “mutually exclusive alternative splicing” refers to the choice between two exons or groups of exons, of which, an exon or group of exons of the two will be spliced. In other words, mutually exclusive splicing events are not independent, leaving only one of the exons or groups of exons in an RNA to be processed, but not both (that is, “mutually exclusive”). For example, the inclusion of an iExon, by itself, cannot result in a deletion. However, in an alternative mutually exclusive splicing event, such inclusion may also result in skipping exons upstream or downstream of iExon and in a delation when one exon or the other is removed (spliced out). In other aspects described herein, the term "alternative non-mutually exclusive splicing" refers to independent splicing events in which one or the other or both exons or groups of exons in an RNA can be processed.
[0013] [0013] Thus, in one aspect, the invention provides methods for modulating the amount of RNA transcripts produced from the precursor RNA containing an endogenous or non-endogenous intronic REMS. In another aspect, the invention provides artificial gene constructs that comprise an endogenous or non-endogenous intronic REMS, which can be used in the context of, e.g. eg, gene therapy or reporter trials. In another aspect, the invention provides methods for altering endogenous genes so that they contain an intronic REMS or an additional intronic REMS.
[0014] [0014] In another aspect, the invention provides methods for modulating the amount of one or more RNA transcripts (e.g., mRNA transcripts) or proteins expressed as the product of one or more genes, wherein the transcripts of the precursor RNA, transcribed by one or more of the genes, comprise an intronic REMS, in which the methods comprise putting a cell in contact with a compound of Formula (1): W. and N — N (1) or a form thereof , where W, X, A and B are as defined herein.
[0015] [0015] In one aspect, the invention provides a method to modulate the amount of an RNA transcript produced from the precursor RNA containing an intronic recognition element for splicing modifier (iREMS), where the method comprises placing a cell containing the precursor RNA in contact with a compound of Formula (I) or a form thereof, where the intronic REMS comprises the sequence NNGAgurngn (SEQ ID NO: 1), where r is adenine or guanine en or N is any nucleotide, wherein the precursor RNA is a gene described herein. In another aspect, the invention provides a method for modulating the amount of an RNA transcript produced from precursor RNA containing an intronic splicing modifier (REMS) recognition element, in which the method comprises bringing the precursor RNA into contact with a compound of Formula (I) or a form thereof, wherein the intronic REMS comprises the sequence NNGAgurngn (SEQ ID NO: 1), where r is adenine or guanine and n or N is any nucleotide, where the precursor RNA is a gene described here. In some respects, the intronic REMS comprises the sequence NNGAguragu (SEQ ID NO: 3) at the RNA level, where r is adenine or guanine and N is any nucleotide. In certain respects, the intronic REMS comprises a sequence selected from the group consisting of ANGAgurngn (SEQ ID NO: 4), CNGAqgurngn (SEQ ID NO: 5), GNGAgurngn (SEQ ID NO: 6), UNGAgurngn (SEQ ID NO : 7), NAGAgurngn (SEQ ID NO: 8), NCGAgurngn (SEQ ID NO: 9), NGGAgurngn (SEQ ID NO: 10), NUGAgurngn (SEQ ID NO: 11), AAGAgurngn (SEQ ID NO: 12), ACGAgurngn (SEQ ID NO: 13), AGGAgurngn (SEQ ID NO: 14), AUGAgurngn (SEQ ID NO: 15), CAGAgurngn (SEQ ID NO: 16), CCGAgurngn (SEQ ID NO: 17), CGGAqgurngn (SEQ ID NO: 18), CUGAgurngn (SEQ ID NO: 19), GAGAgurngn (SEQ ID NO: 20), GCGAgurngn (SEQ ID NO: 21) GGGAgurngn (SEQ ID NO: 22), GUGAgurngn (SEQ ID NO: 23), UVAGAgurngn (SEQ ID NO: 24), UCGAgurngn (SEQ ID NO: 25), UGGAgurngn (SEQ ID NO: 26) and UUGAgurngn (SEQ ID NO: 27), where r is adenine or guanine en or N is any nucleotide.
[0016] [0016] In some respects, the intronic REMS comprises a sequence selected from the group consisting of ANGAguragu (SEQ ID NO: 28), CNGAguragu (SEQ ID NO: 29), GNGAguragu (SEQ ID NO: 30), UNGAguragu ( SEQ ID NO: 31), NAGAguragu (SEQ ID NO: 32), NCGAguragu (SEQ ID NO: 33), NGGAguragu (SEQ ID NO: 34), NUGAguragu (SEQ ID NO: 35), AAGAguragu (SEQ ID NO: 36) ), ACGAguragu (SEQ ID NO: 37), AGGAgQuragu (SEQ ID NO: 38), AUGAguragu (SEQ ID NO: 39), CAGAguragu (SEQ ID NO: 40), CCGAguragu (SEQ ID NO: 141)
[0017] [0017] In a specific aspect, the intronic REMS mentioned in a method or artificial gene construction described here comprises, at the RNA level, a sequence shown in Table 1 (where r is adenine or guanine, en or N is any nucleotide) .
[0018] [0018] Table 1. RNA intronic REMS sequence (where r is adenine or guanine, and n or N is any nucleotide) SFQ TD Sequence SEo TD Sequence SEQ TD Sequence SsEo TD Sequence no. | equitable in no. It's NO. Pequer No. | Small [eme Jememe | cc deem | 7 eee [Rs uacrgumnen | 9 fncengurnan | 10 Ncengeenn | 1Z fucaseenSA | [Es encnguman | 17 fecengumnan | 18 Jecengermon | 19. evensueman | [Es acagurasn | 59 facagurcan | the Nacagendam | 6 [NaGaguTaSA | [52 anengurasn | 53 fancagurcan | 6th ancagunGm | 65 nncagunaSn | [55 encngurasn | 67 fencagurcan | 68 Jcnagunaom | 69 encaounaon |
[0019] [0019] In one aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the method comprises bringing a cell into contact with a compound of Formula (TI) or a form of it. In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the precursor transcript, transcribed from the gene comprises an intronic REMS, the method comprising placing a cell in contact with a compound of Formula (1) or a form thereof. In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts from a gene, disclosed in International Patent Application No. PCT / US2014 / 071252 (International Publication No. WO 2015/105657), in that the precursor transcript, transcribed from the gene comprises an intronic REMS, the method comprising placing a cell in contact with a compound of Formula (1) or a form thereof. In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene, disclosed in International Patent Application No. PCT / US2016 / 034864 (International Publication No. WO 2016/196386), in that the precursor transcript, transcribed from the gene comprises an intronic REMS, the method comprising placing a cell in contact with a compound of Formula (1) or a form thereof. In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts from a gene, disclosed in International Patent Application No. PCT / US2017 / 063323 (International Publication No. WO / 2018/098446), wherein the precursor transcript, transcribed from the gene comprises an intronic REMS, the method comprising placing a cell in contact with a compound of Formula (1) or a form thereof.
[0020] [0020] In one aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the method comprises bringing a cell into contact with a compound of Formula (1) or a form of it. In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the precursor transcript, transcribed from the gene comprises an intronic REMS, the method comprising placing a cell in contact with a compound of Formula (1) or a form thereof.
[0021] [0021] In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, in which the precursor transcript, transcribed from the gene comprises an intronic REMS, the method comprising placing a cell in contact with a compound of Formula (1) or a form thereof. In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, comprising bringing a cell into contact with a compound of Formula (1) or a form thereof. In certain aspects, the cell is brought into contact with the compound of Formula (1) or a form of it in a cell culture. In other respects, the cell is brought into contact with the compound of Formula (I) or a form of it in an individual (eg, a non-human animal or a human).
[0022] [0022] In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS , the methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a vehicle, excipient or pharmaceutically acceptable diluent. In one aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts from a gene described herein, methods comprising administering to a human or non-human individual a compound of Formula (1) or a form of the same, or a pharmaceutical composition comprising a compound of Formula (LI), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[0023] [0023] In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS , the methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a vehicle, excipient or pharmaceutically acceptable diluent.
[0024] [0024] In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS , the methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (IT), or a form thereof, and a vehicle, excipient or pharmaceutically acceptable diluent.
[0025] [0025] In another aspect, the invention provides methods for modulating the amount of one, two, three or more RNA transcripts of a gene described herein, comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. See the examples section for additional information regarding the genes described here. In some respects, a compound of Formula (1) is a compound selected from the compound described herein.
[0026] [0026] In another aspect of any of the previous methods for modulating the amount of one, two, three or more RNA transcripts of a gene described here, the elements of the minimally necessary functional intronic RMES comprise, in the 5 to 3 'sense: an intronic REMS sequence, a branch point sequence and a 3 'splice site sequence.
[0027] [0027] In another aspect, the invention provides a method for modulating the amount of an RNA transcript comprising an RNA nucleotide sequence, wherein the RNA nucleotide sequence comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the nucleotide sequence of the intron RNA comprises in the 5 '/ to 3' direction: a first splice site 5 ', a first branching point, a first splice site 3 ", an iREMS, a second branch point and a second splice site 3 ', where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, in which the method comprises bringing the RNA transcript into contact with a compound described herein (for example, a compound of Formula (I) or a form of the same or other small molecule splicing modulator compound). In a specific aspect, the RNA transcript is a transcript of an aqu gene i described (p. in a table or in the examples of the present). In a specific aspect, iREMS is not endogenous.
[0028] [0028] In another aspect, the invention provides a method for modulating the amount of an RNA transcript comprising an RNA nucleotide sequence, wherein the RNA nucleotide sequence comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, in which the nucleotide sequence of the intron RNA comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an iREMS, in that iREMS comprises a sequence of GAgurngn RNA, where r is adenine or guanine and n is any nucleotide, wherein the method comprises contacting the RNA transcript with a compound described herein (for example, a compound of Formula (I) or a form of the same or other small molecule splicing modulator compound). In a specific aspect, the RNA transcript is a transcript of a gene described herein (eg, in a table or in the examples herein). In a specific aspect, iREMS is not endogenous.
[0029] [0029] In another aspect, the invention provides a method for modulating the amount of an RNA transcript comprising an RNA nucleotide sequence, wherein the RNA nucleotide sequence comprises two exons and an intron, the sequence of which RNA nucleotides comprise exonic and intronic elements illustrated in Figure 1A, in which the method comprises bringing the RNA transcript into contact with a compound described herein (for example, a compound of Formula (II) or a form of the same or another modulator compound small molecule splicing). In a specific aspect, the RNA transcript is a transcript of a gene described herein (eg, in a table or in the examples herein). In a specific aspect, iREMS is not endogenous.
[0030] [0030] In another aspect, the invention provides a method for modulating the amount of an RNA transcript comprising an RNA nucleotide sequence, wherein the RNA nucleotide sequence comprises two exons and an intron, the sequence of which RNA nucleotides comprise exonic and intronic elements illustrated in Figure 1B, in which the method comprises bringing the RNA transcript into contact with a compound described herein (for example, a compound of Formula (I) or a form of the same or other modulator compound small molecule splicing). In a specific aspect, the RNA transcript is a transcript of a gene described herein (eg, in a table or in the examples herein). In a specific aspect, iREMS is not endogenous.
[0031] [0031] In another aspect, the invention provides a method for modulating the amount of an RNA transcript comprising an RNA nucleotide sequence, wherein the RNA nucleotide sequence comprises three exons and two introns, the sequence of which RNA nucleotides comprise exonic and intronic elements illustrated in Figure 1C, in which the method comprises bringing the RNA transcript into contact with a compound described herein (for example, a compound of Formula (I) or a form of the same or other modulator compound small molecule splicing). In a specific aspect, the RNA transcript is a transcript of a gene described herein (eg, in a table or in the examples herein). In a specific aspect, iREMS is not endogenous.
[0032] [0032] In a specific aspect, the RNA transcript is the RNA transcript of a gene described in a table in this invention.
[0033] [0033] In another aspect, the invention provides a method for modulating the amount of the product of a gene (such as an RNA transcript or a protein) in an individual, wherein the gene comprises a DNA nucleotide sequence that encodes two exons and an intron, where the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence that encodes the intron, and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence that encodes the intron, in that the nucleotide sequence of the DNA encoding the intron comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a first 5 'splice site, a nucleotide sequence that encodes a first branching point, a nucleotide sequence that encodes a first 3 'splice site, a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a second branch point and a nucleotide sequence eos encoding a second 3 'splice site, wherein the nucleotide sequence encoding the iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form of the same or other small molecule splicing modulator compound) to the subject.
[0034] [0034] In another aspect, the invention provides a method for modulating the amount of the product of a gene (such as an RNA transcript or a protein) in an individual, wherein the gene comprises a nucleotide sequence of DNA encoding two exons and an intron, where the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence that encodes the intron, and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence that encodes the intron, in that the intron DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a branch point, a nucleotide sequence that encodes a 3 'splice site and a nucleotide sequence that encodes an iREMS , wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compos as described herein (for example, a compound of Formula (1) or a form thereof or another small molecule splicing modulator) to the subject.
[0035] [0035] In another aspect, the invention provides a method for modulating the amount of the product of a gene (such as an RNA or protein transcript) in an individual, wherein the gene comprises a nucleotide sequence of DNA encoding two exons and an intron, wherein the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, where the The nucleotide sequence of the intron DNA comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a branch point and a nucleotide sequence that encodes a 3 'splice site, in that the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound aq as described (for example, a compound of Formula (1) or a form of the same or other small molecule splicing modulator compound) to the subject.
[0036] [0036] In another aspect, the invention provides a method for modulating the amount of the product of a gene (such as an RNA or protein transcript) in an individual, wherein the gene comprises a nucleotide sequence of DNA encoding two exons and an intron, the DNA nucleotide sequence encoding exonic and intronic elements illustrated in Figure 1A, where the method comprises administering a compound described here (for example,
[0037] [0037] In another aspect, the invention provides a method for modulating the amount of the product of a gene (such as an RNA or protein transcript) in an individual, wherein the gene comprises a DNA nucleotide sequence that encodes two exons and an intron, the DNA nucleotide sequence encoding exonic and intronic elements illustrated in Figure 1B, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form of the same or another compound small molecule splicing modulator) to the individual.
[0038] [0038] In another aspect, the invention provides a method for modulating the amount of the product of a gene (such as an RNA or protein transcript) in an individual, wherein the gene comprises a DNA nucleotide sequence that encodes two exons and an intron, the nucleotide sequence of DNA encoding exonic and intronic elements illustrated in Figure 1C, wherein the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form of the same or another compound small molecule splicing modulator) to the individual.
[0039] [0039] In a specific aspect, the gene is a gene described in a table in this invention.
[0040] [0040] In another aspect, the invention provides methods for preventing and / or treating a disease associated with the abnormal expression of a gene product (eg, an mRNA or protein transcript), in which the precursor RNA transcript, transcribed from the gene,
[0041] [0041] In another aspect, the invention provides methods for preventing and / or treating a disease in which a variation in the level of expression of one, two, three or more RNA isoforms encoded by a gene is beneficial for the prevention and / or the treatment of the disease, in which the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, in which the methods comprise administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In one aspect, the invention provides methods for preventing and / or treating a disease in which modulation (eg, increase or decrease) in the expression of one, two, three or more isoforms of RNA encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, wherein the methods comprise administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (LI) , or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[0042] [0042] In another aspect, the invention provides methods for preventing and / or treating a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more isoforms of RNA encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, in which the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula ( I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[0043] [0043] In another aspect, the invention provides methods for preventing and / or treating a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more RNA isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, in which the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula ( 1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In another aspect, the invention provides methods for preventing and / or treating a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more RNA isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, one, two, three or more RNA isoforms encoded by a gene described herein are decreased after administration of a compound of Formula (II), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent . See the examples section for additional information regarding the genes described here. In certain respects, a compound of Formula (1) is a compound selected from the compound described herein.
[0044] [0044] In another aspect, the invention provides methods for preventing and / or treating a disease in which a variation in the level of expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or the treatment of the disease, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[0045] [0045] In one aspect, the invention provides methods for preventing and / or treating a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (II ), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[0046] [0046] In another aspect, the invention provides methods for preventing and / or treating a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene described here is beneficial for the prevention and / or treatment of the disease, in which the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, in which the methods comprise administering to a human or non-human individual a compound of Formula (IL) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In another aspect, the invention provides methods for preventing and / or treating a disease in which modulation (eg, increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[0047] [0047] In another aspect, the invention provides methods for preventing and / or treating a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1 ), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, one, two, three or more RNA isoforms encoded by a gene described herein are decreased after administration of a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent . See the examples section for additional information regarding the genes described here. In certain respects, a compound of Formula (1) is a compound selected from the compound described herein.
[0048] [0048] In another aspect, the invention provides a method to prevent, treat or to prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a nucleotide sequence of DNA encoding two exons and an intron, in which the nucleotide sequence encoding a first exon is upstream of the nucleon sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the DNA that encodes the intron comprises towards 5 'to 3': a nucleotide sequence that encodes a first splice site 5 ', a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first splice site 3 ', a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a second branch point, and a nucleotide sequence that encodes a second splice site 3', wherein the nucleotide sequence that encodes iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form of the same or other splicing modulator compound of small molecule) to the individual.
[0049] [0049] In another aspect, the invention provides a method to prevent, treat or to prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a nucleotide sequence of DNA encoding two exons and an intron, in which the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the intron DNA comprises in the 5 'direction ” for 3 ': a nucleotide sequence that encodes a branch point, a nucleotide sequence that encodes a 3' splice site, and a nucleotide sequence that encodes an iREMS, where the nucleotide sequence that encodes iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form of the same or another compound small molecule splicing modulator) to the individual.
[0050] [0050] In another aspect, the invention provides a method to prevent, treat or to prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, with the nucleotide sequence of the DNA encoding elements exonics and intronics illustrated in Figure 1A, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form thereof or another small molecule splicing modulator) to the individual.
[0051] [0051] In another aspect, the invention provides a method to prevent, treat or to prevent and treat a disease in an individual, in which the modulation (eg, increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, with the nucleotide sequence of the DNA encoding elements exonics and intronics illustrated in Figure 1B, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form thereof or another small molecule splicing modulator) to the individual.
[0052] [0052] In another aspect, the invention provides a method for preventing, treating or for preventing and treating a disease in an individual, in which the modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, with the nucleotide sequence of the DNA encoding elements exonic and intronic compounds illustrated in Figure 1C, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form of the same or other small molecule splicing modulator compound) to the individual.
[0053] [0053] In a specific aspect, the gene is a gene described in a table in this invention.
[0054] [0054] In another aspect, the invention provides artificial gene constructions. In one aspect, the invention provides an artificial gene construct that comprises endogenous DNA modified to introduce a non-endogenous nucleotide sequence that encodes an intron including 3 'splice site (s), branch point (s) and an intronic REMS. In another aspect, the invention provides an artificial gene construct comprising DNA encoding exons and one, two or more introns, in which a nucleotide sequence encoding an intronic REMS, functioning as a 5 'splice site in the presence of a compound described here,
[0055] [0055] In a specific aspect, the nucleotide sequence of the intronic REMS introduced in the nucleotide sequence of the artificial gene construct comprises the sequence NNGAgtrngn (SEQ ID NO: 1808), where r is adenine or guanine and n or N is any nucleotide. In a specific aspect, in the context of DNA, the nucleotide sequence encoding the intronic REMS comprises a sequence selected from the group consisting of ANGAgtrngn (SEQ ID NO: 1809), CNGAgtrngn (SEQ ID NO: 1810), GNGAgtrngn ( SEQ ID NO: 1811), TNGAgtrngn (SEQ ID NO: 1812), NAGAgtrngn (SEQ ID NO: 1813), NCGAgtrngn (SEQ ID NO: 1814), NGGAgtrngn (SEQ ID NO: 1815), NTGAgtrngn (SEQ ID NO: 1816 ), AAGAgtrngn (SEQ ID NO: 1817), ACGAgtrngn (SEQ ID NO: 1818), AGGAgtrngn (SEQ ID NO: 1819), ATGAgtrngn (SEQ ID NO: 1820), CAGAgtrngn (SEQ ID NO: 1821), CCGAgtrngn (SEQ ID NO: 1822), CGGAgtrngn (SEQ ID NO: 1823), CTGAgtrngn (SEQ ID NO: 1824), GAGAgtrngn (SEQ ID NO: 1825), GCGAgtrngn (SEQ ID NO: 1826), GGGAgtrngn (SEQ ID NO: 1827) , GTGAgtrngn (SEQ ID NO: 1828), TAGAgtrngn (SEQ ID NO: 1829), TCGAgtrngn (SEQ ID NO: 1830), TGGAgtrngn (SEQ ID NO: 1831) and TTGAgtrngn (SEQ ID NO:
[0056] [0056] In a more specific aspect, in the context of DNA, the nucleotide sequence encoding the intronic REMS comprises a sequence selected from the group consisting of ANGAgtragt (SEQ ID NO: 1833), CNGAgtragt (SEQ ID NO: 1834 ), GNGAgtragt (SEQ ID NO: 1835), TNGAgtragt (SEQ ID NO: 1836), NAGAgtragt (SEQ ID NO: 1837), NCGAgtragt (SEQ ID NO: 1838), NGGAgtragt (SEQ ID NO: 1839), NTGAgtragt (SEQ ID NO: 1839), NTGAgtragt (SEQ ID NO: 1839), NTGAgtragt ID NO: 1840), AAGAgtragt (SEQ ID NO: 1841), ACGAgtragt (SEQ ID NO: 1842), AGGAgtragt (SEQ ID NO: 1843), ATGAgtragt (SEQ ID NO: 1844), CAGAgtragt (SEQ ID NO: 1845) , CCGAgtragt (SEQ ID NO: 1846), CGGAgtragt (SEQ ID NO: 1847), CTGAgtragt (SEQ ID NO: 1848), GAGAgtragt (SEQ ID NO: 1849), GCGAgtragt (SEQ ID NO: 1850), GGGAgtragt (SEQ ID NO: 1851), GTGAgtragt (SEQ ID NO: 1852), TAGAgtragt (SEQ ID NO: 1853), TCGAgtragt (SEQ ID NO: 1854), TGGAgtragt (SEQ ID NO: 1855) and TTGAgtragt (SEQ ID NO: 1856), where r is adenine or guanine and N is any nucleotide. In one or more aspects provided, N is adenine or guanine A or G. In several specific aspects, the nucleotide sequence encoding the intronic REMS is a nucleotide sequence encoding a non-endogenous intronic REMS, that is, an RNA transcript precursor comprising non-endogenous intronic REMS not found naturally in the DNA sequence of the artificial construct.
[0057] [0057] In a specific aspect, the intronic REMS mentioned in a method or artificial gene construction described here comprises, at the DNA level, a sequence shown in Table 2 (where r is adenine or guanine and n or N is any nucleotide).
[0058] [0058] Table 2. DNA intronic REMS sequence (where r is adenine or guanine and n or N is any nucleotide) ID ID ID NO.
[0059] [0059] In certain aspects, the invention provides a vector that comprises the artificial gene construction described here. In some aspects, the invention provides a cell comprising an artificial gene construct described herein or a vector comprising an artificial gene construct described herein.
[0060] [0060] In another aspect, the invention provides a method of modulating the amount and modifying the type of a protein produced by a cell containing an artificial gene construct described herein. In one aspect, the invention provides a method of modulating the amount and modifying the type of a protein produced by a cell containing an artificial gene construct described herein, wherein the method comprises bringing the cell into contact with a compound of Formula (I) or a form of it. In some ways, the artificial gene construct encodes a therapeutic protein. In some ways, the artificial gene construct encodes a non-functional protein. In some aspects of the production of a therapeutic protein, the artificial gene construct can also encode a detectable reporter protein. In some aspects of the production of a non-functional protein, the artificial gene construct can also encode a detectable reporter protein.
[0061] [0061] In another aspect, the invention provides a method of modulating the amount of a protein produced by an individual, in which an artificial gene construct described herein is or has been administered to the individual. In one aspect, the invention provides a method of regulating the amount of a protein produced by an individual, wherein the method comprises: (a) administering an artificial gene construct or a vector comprising the artificial gene construct described herein to the individual; and (b) administering a compound of Formula (I) or a form thereof to the individual. In another aspect, the invention provides a method of regulating the amount of a protein produced by an individual, wherein the method comprises administering a compound of Formula (1) or a form thereof to an individual carrying a gene containing a sequence of nucleotides encoding an intronic REMS. In another aspect, the invention provides a method of regulating the amount of a protein produced by an individual, wherein the method comprises administering a compound of Formula (1) to the individual, in which an artificial gene construct described herein has been administered prior to the individual . In some ways, the artificial gene construct can encode a therapeutic or a non-functional protein. In some ways, the artificial gene construct encodes a detectable reporter protein. In some ways, the individual is not human. In specific aspects, the individual is human.
[0062] [0062] In one aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of an RNA transcript produced from a precursor RNA that comprises a nucleotide sequence of the RNA in the 5 'to 3 direction ": a branching point, a 3 'splice site and an endogenous or non-endogenous intronic splicing modifier (REMS) recognition element, where the intronic REMS comprises a GAgurngn RNA sequence, where r is adenine or guanine (A or G, respectively) and n is any nucleotide, in which the method comprises bringing the precursor RNA into contact with a compound of Formula (1) or a form thereof, in which the compound of Formula (1) is:
[0063] [0063] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of an RNA transcript, produced from a precursor RNA comprising a 5 to 3 RNA nucleotide sequence ': a branch point, a splice site 3' and an endogenous or non-endogenous intronic splicing modifier (REMS) recognition element, where the intronic REMS comprises a GAgurngn RNA sequence, where r is adenine or guanine en is any nucleotide, in which the method comprises bringing the precursor RNA into contact with a compound of Formula (1) or a form thereof, in which the compound of Formula (1) is selected from a compound of Formula (Ia) and Formula (Tb): AY AA, N = N 4 NA (Ia) (Ib) or a form thereof, where: x is CHo, CH (Cisalkyl), C (Cisalkyl), », CH = CH, O, NRs Or a bond; A is aryl, heteroaryl, heterocyclyl or Ca-10cycloalkyl, where the aryl is selected from phenyl and naphthyl, each optionally substituted with 1, 2, 3 or 4 substituents, each selected from Ri, where the heteroaryl is a monocyclic, bicyclic or tricyclic saturated ring system with 1, 2 or 3 heteroatoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or substituents, each selected from Ri,
[0064] [0064] In one aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of an RNA transcript produced from a precursor RNA comprising a 5 'to 3 nucleotide sequence of the RNA ': a branch point, a splice site 3' and an endogenous or non-endogenous intronic splicing modifier (REMS) recognition element, where the intronic REMS comprises an NNGAgurngn RNA sequence (SEQ ID NO: 1), where r is adenine or guanine en or N is any nucleotide, wherein the method comprises bringing the precursor RNA into contact with a compound of Formula (I) or a form thereof in which the compound of Formula (1) is:
[0065] [0065] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of an RNA transcript produced from a precursor RNA comprising a 5 "to 3 nucleotide sequence of the RNA ": a branch point, a 3 'splice site, and an intronic splicing modifier recognition element
[0066] [0066] In one aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a DNA nucleotide sequence that encodes an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a branching point, a nucleotide sequence that encodes a 3 'splice site and a nucleotide sequence encoding an endogenous or non-endogenous intronic REMS, where the nucleotide sequence encoding the endogenous or non-endogenous intronic REMS comprises a GAgtrngn DNA sequence, where r is adenine or guanine and n is any nucleotide, where the method comprises administering a compound of Formula (I) to the individual, wherein the compound of Formula (1) is:
[0067] [0067] In one aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a DNA nucleotide sequence that encodes an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an endogenous or non-endogenous intronic REMS, a nucleotide sequence that encodes a branch point and a sequence of nucleotides encoding a 3 'splice site, where the nucleotide sequence encoding the endogenous or non-endogenous REMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the method comprises administering a compound of Formula (1) to the individual, wherein the compound of Formula (1) is: W.
[0068] [0068] In another aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a nucleotide sequence of DNA encoding an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a branch point, a nucleotide sequence that encodes a 3 'splice site, and the nucleotide sequence encoding an endogenous or non-endogenous intronic REMS, where the nucleotide sequence encoding endogenous or non-endogenous REMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the method comprises administering a compound of Formula (I) to the individual, wherein the compound of Formula (1) is selected from a compound of Formula (Ta) and Formula (Tb): AY IA, N = N 4 NA 8 (Ia) (Ib) or a form thereof, where x is CHo, CH (Ciasalkyl), C (Cisalkyl), ', CH = CH, O, NR5s or a bond; A is aryl, heteroaryl, heterocyclyl or Ca-10cycloalkyl, where the aryl is selected from phenyl and naphthyl, each optionally substituted with 1, 2, 3 or 4 substituents, each selected from Ri, where the heteroaryl is a monocyclic, bicyclic or tricyclic saturated ring system with 1, 2 or 3 heteroatoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or substituents, each selected from Ri,
[0069] [0069] In another aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene that comprises a nucleotide sequence of DNA encoding an endogenous or not endogenous REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an endogenous or non-endogenous intronic REMS, a nucleotide sequence that encodes a branch point and a sequence of nucleotides encoding a 3 'splice site, wherein the nucleotide sequence encoding the endogenous or non-endogenous REMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound of Formula (1) to the individual, where the compound of Formula (1) is selected from a compound of Formula (Ia) and Formula (Ib): A) O É N = N 4 Na 8 (Ia) (Tb) or a shape of m haphazard, where: x is CHo, CH (Cisalkyl), C (Cisalkyl) ', CH = CH, O, NRs or a bond; A is aryl, heteroaryl, heterocyclyl or Ca-10cycloalkyl, where the aryl is selected from phenyl and naphthyl, each optionally substituted with 1, 2, 3 or 4 substituents, each selected from Ri, where the heteroaryl is a monocyclic, bicyclic or tricyclic saturated ring system with 1, 2 or 3 heteroatoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or substituents, each selected from R1, where the heterocyclyl is a saturated or partially unsaturated monocyclic, bicyclic or tricyclic ring system with 1, 2 or 3 heteroatoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or 5 substituents, each selected from R7, and where Cyclocycloalkyl is a saturated or partially unsaturated bicyclic ring system optionally substituted with 1, 2, 3, 4 or 5 substituents, each one if taught from Ro;
[0070] [0070] In one aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a DNA nucleotide sequence that encodes an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a branching point, a nucleotide sequence that encodes a 3 'splice site and a nucleotide sequence encoding an endogenous or non-endogenous intronic REMS, where the nucleotide sequence encoding the endogenous or non-endogenous REMS comprises a DNA sequence NNGAgtrngn (SEQ ID NO: 1808), where r is adenine or guanine en or N is any nucleotide, wherein the method comprises administering a compound of Formula (I) to the individual, wherein the compound of Formula (1) is:
[0071] [0071] In one aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a nucleotide sequence of DNA encoding an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an endogenous or non-endogenous intronic REMS, a nucleotide sequence that encodes a branch point and a sequence of nucleotides encoding a 3 'splice site, where the nucleotide sequence encoding the endogenous or non-endogenous REMS comprises a DNA sequence NNGAgtrngn (SEQ ID NO: 1808), where r is adenine or guanine en or N is any nucleotide, wherein the method comprises administering a compound of Formula (1) to the individual, wherein the compound of Formula (1) is:
[0072] [0072] In another aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a DNA nucleotide sequence that encodes an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a branching point, a nucleotide sequence that encodes a 3 'splice site and a nucleotide sequence encoding an endogenous or non-endogenous intronic REMS, wherein the nucleotide sequence encoding endogenous or non-endogenous REMS comprises a DNA sequence NNGAgtrngn (SEQ ID NO: 1808), where r is adenine or guanine en or N is any nucleotide, wherein the method comprises administering a compound of Formula (I) to the individual, wherein the compound of Formula (I) is selected from a compound of Formula (Ia) and Formula (Ib):
[0073] [0073] In another aspect, the invention provides a method of modifying RNA splicing in order to modulate the amount and type of a protein produced by a gene comprising a DNA nucleotide sequence that encodes an endogenous or not intrinsic REMS endogenous in an individual, where the DNA nucleotide sequence comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an endogenous or non-endogenous intronic REMS, a nucleotide sequence that encodes a branch point and a sequence of nucleotides encoding a 3 'splice site, wherein the nucleotide sequence encoding the endogenous or non-endogenous REMS comprises a DNA sequence NNGAgtrngn (SEQ ID NO: 1808) where r is adenine or guanine en or N is any nucleotide, wherein the method comprises administering a compound of Formula (1) to the individual, wherein the compound of Formula (1) is selected from a compound of Formula (Ia) and Formula (Tb): A) IO É N = N 4 NE B (Ia) (Tb) or a form thereof, where: x is CHo, CH (Cisalkyl), C (Cisalkyl) ', CH = CH, O, NRs or a bond; A is aryl, heteroaryl, heterocyclyl or Ca-10cycloalkyl, where the aryl is selected from phenyl and naphthyl, each optionally substituted with 1, 2, 3 or 4 substituents, each selected from Ri, where the heteroaryl is a monocyclic, bicyclic or tricyclic saturated ring system with 1, 2 or 3 heteroatoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or substituents, each selected from Ri, where the heterocyclyl is a saturated or partially unsaturated monocyclic, bicyclic or tricyclic ring system with 1, 2 or 3 heteroatoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or 5 substituents, each selected from R7, and where Caiocycloalkyl is a saturated or partially unsaturated bicyclic ring system optionally substituted with 1, 2, 3, 4 or 5 substituents, each one selected from Ro;
[0074] [0074] In a specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCAl, ABCAlO, ABCB7, ABCB8, ABCC1, ABCC3, ABHD1O0, ABL2, ABLIM3, ACACA , ACADVL, ACAT2, ACTA2, ADAL, ADAM12, ADAMI15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS19, ADCY3, ADDl, ADGRG6, ADH6, ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AH2 , AJUBA, AKO21888, AK310472, AKAPl, AKAP3, AKAP8L, AKAP9, AKNA, AKTl, ALCAM, ALDH4Al, AMPD2, ANK1, ANK2, ANK3, ANKFYl, ANKHDI-EIF4EBP3, ANKRA2, ANK, ANKD2, ANKD2, ANKD2 , ANXAll, ANXA6, AP2Bl, AP4BI1-AS1, APAF1, APIP, APLP2, APOA2Z, APP, APPL2, APTX, ARHGAPl, ARHGAPI12, ARHGAP22, ARHGAP5, ARHGEF16, ARIDIA, ARID2, ARID5B, ARL5, ARL5B, ARL5 , ARSJ, ASAPl, ASIClI, ASL, ASNS, ASPH,
[0075] [0075] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from a gene that is selected from: ABCAl, ABCB7, ABCCl, ABHD1IO, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ADAM1I2 , ADAM15, ADAM1I7, ADAM33, AFF2, AGK, AGPAT3, AGPS, AHCYL2, AHDCl, AHRR, AJUBA, AKO21888, AK310472, AKAP1, AKAP9, AKNA, ALCAM, ALDH4Al, AMPD2, ANK2, ANKFY1, ANKFY1 , ANP32A, ANXAll, ANXA6, AP2Bl, APAF1, APLP2, APP, APPL2, APTX, ARHGAP22, ARIDIA, ARID2, ARMCX3, ASAP1, ASL, ASNS, ASPH, ATAD2ZB, ATF7IP, ATG9A, ATMIN, ATP2Cl, ATX, ATN , B4GALT2, BACEl, BAG2, BASPl, BCO033281, BCAR3, BEND6, BICDl, BINlI, BNCl, BRD2, BRPFl, BSCL2, BTBD1O, B2ZWl, Cllorf30, Cllorf73, Cl7orf / 76-ASl, C40rf27, C4rf27 , CALU, CAMKK1l, CAPNS1l, CASC3, CASP8SAP2, CAV1, CCARI, CCDC77, CCDC88A, CCDC92, CCTG6A, CD276, CD46, CDC25B, CDC40, CDC42BPA, CDCA7, CDHll, CDH13, CDK11B, CDK1, , CIZl, CLICl, CLK4, CNOTl, COG1l, COLI12 A1l, COLI1Al, COL6Al, COPS7B, CPEB2, CREB5, CRLSl, CRTAP, CSDE1l, CSNKI1Al, CTDSP2, CTNNDl, CUL2, CUL4A, CUXl, CYB5B, CYBRDI1, CYPS1Al1, DAB2, DBL, DXX, DACT, DCUN1D4, DDAH1, DDAH2, DDHD2, DDR1l, DDX39B, DDX42, DENNDIA, DENNDIB, DENND5SA, DGCR2, DGKA, DHCR24, DHCR7, DHFR, DHX9, DIAPH1, DIAPH3, DIS3L, DKFZp434M172, DKND, DOC DSEL, DST, DSTN, EBF1, EEAl, EEF1Al, EFCAB14, EGR1, EHMT2, EIF2B3, EIF4Gl, EIF4G2, EIF4G3, ELF2, ENG, ENPP2, ENSA, EPNI1, EPT1, ERCl, ERGIC3, EL5, E3, EXT FADSl, FADS2, FAFl, FAM111A, FAMI98B, FAM219A, FAM219B, FAM3C, FAM65A, FBXO1lO,
[0076] [0076] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCB8, ANKRD36, APLP2, ARHGAP12, ARMCX6, ASAP1l, ATG5, AXIN1, BIRC6, Clorf86 , CDC42BPA, CLTA, DYRKIA, ERGIC3, FBXL6, FOXM1, GGCT, KAT6B, KDM6A, KIF3A, KMT2D, LARP7, LYRM1l, MADD, MAN2C1, MRPL55, MYCBP2, MYOSB, SISN, RISP, RAP, , SREKl, STRN3, TAF2, TMEM134, VPS29, ZFAND1 and ZNF431.
[0077] [0077] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCB8, ANKRD36, ARHGAP1l2, ARMCX6, ATG5, BIRC6, Clorf86, CLTA, DYRKIA, FBXL6 , KAT6B, KDM6A, KMT2D, LYRM1l, MAN2C1, MRPL55, MYCBP2, PNISR, RAPGEFl1, SENP6, SH3YLl, TMEM134 and ZNF431.
[0078] [0078] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCA1I0, ABCC1, ACTA2, ADAL, ADAM12, ADAMTS1, ADAMTSS5, ADD1l, ADGRG6, ADH6 , ADHFEl, AFF2, AFF3, AGK, AGPS, AKAP3, ANKI1, ANK2, ANK3, ANKRD33B, ANXAll, ANXAG6, AP4B1-AS1, ARHGEF16, ARIDSB, ARL9, ARMCX3, ASAPl, ASIC1, ATP2A3, B3, B3, B3, B3, B3 , BIN3-ITl, BIRC3, BTG2, Cl0Oorf54, Cllorf70, Cllorf73, Cllorf94, Cl20rf56, Cl9o0orf47, C3, C4o0orf27, CT7orf3l, C8orf34, CAl3, CA3, CACNAZD2, CACNBl, CADM1, CDM2, CCM1 , CELSR1, CEMIP, CEP170, CFH, CIITA, CLDN23, CMAHP, CNGA4, CNTD1l, COLI11Al, COLI12Al, COLI14Al1, COL15Al, COLSAl, COL5A3, COL6A6, COL8Al, COLEClI2, COMP, CPA4, CPQ, CRLL2, CPQ, CRLL2 , CYB5SB, CYBSR2, CYGB, CYPIBl,
[0079] [0079] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCAlO, ACTA2, ADAL, ADAMTS1, ADAMTS5, ADDl, ADGRG6, ADH6, ADHFEl, AFF3 , AKAP3, ANKl, ANK3, ANKRD33B, AP4B1-AS1l, ARHGEF16, ARID5B, ARL9, ASIC1, ATP2A3, B3GALT2, B3GNT6, BCL2LI15, BCYRN1, BIN3-ITl, BIRf3, C4, Cl3, C4, Cl3, BT3 , C7orf3l1, C8orf34, CAl3, CA3, CACNA2ZD2, CACNBl, CADM1I, CAND2, CCDC79, CCER2, CCNF, CELSR1I, CEMIP, CEP170, CFH, CIITA, CLDN23, CMAHP, CNGA4, CNTDI, COLA1, COLA1, COLA1, COLA1 , COL6A6, COL8Al, COLEC12, COMP, CPA4, CPQ, CRISPLD2, CRLFl1, CRYL1, CYBSR2, CYGB, CYP1Bl, DCLK1, DCN, DDIT4L, DDX50, DEGS1, DEPTOR, DFNB59, DIRAS3, DLK5, DNAH1, DNA2 , DZIPIL, EFEMPl, EGR3, ELN, ELP4, EMX20S, ENPPl1, ERCC8, ESM1, EVC2, F2R, FAMI60Al, FAM20A, FAM46B, FAM65B, FAP, FARP1, FBLN2, FBN2, FBXO9, FCHOl, FGF1, , FSCN2, GAL3ST4, GALNT15, GATA6, GBGT1, GCNT 1, GDF6, GNAQ, GPR183, GPR50, GPRCS5A, GPRC5SB, GRTPl, GUCAIB, GXYLT1, HAPLN1, HAPLN2, HAS3, HAVCR2, HDAC5, HECTD2-AS1, HEPH, HEY1l, ASMN3
[0080] [0080] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCB8, ABCC3, ADAM17, ADCY3, AGPAT4, ANKRA2, ANXA1l1,
[0081] [0081] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABCB8, ABCC3, ADCY3, AGPAT4, ANKRA2, APIP, ARHGAP1, ARL15, ATXN1, BECN1 , BHMT2, BTN3Al, Cl20rf4, Cl40rfl132, C8orf44, C8orf44-SGK3, C8orf88, CASP7, CCDCl22, CECR7, CENPI, CEP112, CEP192, CHEKl, CMAHP, CNRIPl, CPSF4, CSNK, CRYPL, CRY, , DNAJC13, DNMBP, DYRKI1A, ENAH, EP300, ERCCl, ERLIN2, ERRFIl, EVC, FAIM, FAMI26A, FAMI1I3A, FAM162A, FAMI174A, FBN2, GGACT, GLCE, GULP1, GXYLTGA, HXN, HXN, , IVD, KDM6A, LETM2, LOC400927, LRRC42, LYRM1, MB21D2, MCM10, MED13L, MEFN2, MRPL45, MRPS28, MTERF3, MYCBP2, NGF, OXCTl, PDS5SB, PIGN, PIK3CD, PIKYR1, PLEKY2 , PPIP5SK2, PPPIR26, PRPF31, PRUNE2, PXK, RAFl, RAPGEFl, RARS2, RBKS, RERE, RPAl, RPS10, RPSG6KB2, SAMD4A, SEC24A, SENP6, SERGEF, SGK3, SH3YLl, SKA2, SLCI, SKA2, SLCI , SPIDR, SPRYD7, SRGAP1l, SRRMI1, STXBP6, TASP1, TCF12, TCF4, TIAMI1, TMC3, TMEM189-UBE2V1, TMEM214, TNRC6A, TTC7B, TUBEl, TYW5, URGCP, VAV2, WDR27, WDR91, WNK1, ZCN8, ZCCH8
[0082] [0082] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from, a gene that is selected from: ABHD10, ADAL, ADAM17, ADAM23, ADAMTS19, AGPAT4, AGPS, AKAP8L, AKTl, ANKRD13C , ANXAll, APIP, APPL2, ARHGAP1, ARHGAPS5, ARL15, ARLSB, ARSJ, ASAPl, ATF6, BECN1I, BHMT2, BIN3, BNC2, BTBD10, CI1QTNF9B-AS1, Clorf27, Cllorf30, Clorff4, Clorff4, Cllorf73 , CADM2, CCNL2, CDH18, CENPI, CEP162, CEP1I70, CEP1l92, CEP57, CHEKl, CHRM2, CMAHP, CMSS1, CNOT7, CNRIPl, CNTNl, COPS7B, CRISPLD2, CRYBG3, CUXl, DAAMND, DENI, D42, D42 , DENND5A, DET1l, DGK1, DHFR, DIAPH3, DLG5, DMXL1, DNAJA4, DNMBP, DYRKIA, DZIPIL, ELMO2, ENAH, ENOX1, EP300, ERCl, ERC2, EVC, EXOC3, EXOC6B, FAMIG62A,
[0083] [0083] In another specific aspect described here, the gene is, or the RNA transcript is, transcribed from a gene that is selected from: APOA 2, ASAPl, BRCAl, BRCA2, CDKNIC, CRX, CTRC, DENND5A, DIAPH3 , DMD, DNAH11, EIF2B3, GALC, HPS1, HTT, IKBKAP, KIAAl524, LMNA, MECP2, PAPD4, PAX6, PCCB, PITPNB, PTCHI1, SLC34A3, SMN2, SPINK5, SREKl, TMEM67, VWR, XDH.
[0084] [0084] In another specific aspect described here, the gene is, or the RNA transcript is transcribed from a gene that is selected from: ABCAl, ABCAlIO, ABCB7, ABCB8, ABCCl, ABCC3, ABL2, ABLIM3, ACACA, ACADVL , ACAT2, ACTA2, ADAL, ADAM15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS19, ADCY3, ADDl, ADGRG6, ADH6, ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AKRAA, AKR , AK310472, AKAPl, AKAP3, AKAP8L, AKAP9, AKNA, ALCAM, ALDH4Al, AMPD2, ANK1l, ANK2, ANK3, ANKFYl, ANKHD1- EIF4EBP3, ANKRA2, ANKRD13C, ANKRD17, AN6R2, AN6R3 -AS1, APAFl1, APIP, APOAZ, APP, APTX, ARHGAP1, ARHGAP12, ARHGAP22, ARHGAP5, ARHGEFl6, ARIDIA, ARID2, ARIDSB, ARL9, ARL15, ARLSB, ARMCX3, ARSJ, ASAP, ASAS, ASL , ATF6, ATF7IP, ATG9A, ATMIN, ATP2A3, ATP2C1, ATXN1, ATXN3, AURKA, B3GALT2, B3GNT6, B4GALT2, BACEl, BAG2, BASP1, BC033281, BCAR3, BCL2L,, BYN1, BYN1, BYN1 , BIN3-ITl, BIRC3, BIRC6, BNCl, BNC2, BRCAl, BR CA2, BRD2, BRPF1, BSCL2, BTBD10, BTG2, BTN3Al, BzWl, CIQTNF9B- AS1, Clorf27, Clorf86, ClO0orf54, Cllorf30, Cllorf70, Cllorf73, Cllorf76, Cllorf94, Cl20rf4, Clorfr7, Cl20r76, Cl20 C3, C4o0orf27, C5orf24, C6orf4is, CT7orf3l, C8orf34, C8orf44, C8orf44-SGK3, C8orf88, C9o0rf69, CAl3, CA3, CAB39, CACNA2ZD2, CACNBl, CACNB4, CADM1, CASK, CAS1, CAMK2 CASPBAP2, CAV1, CCARl, CCDCT77, CCDC79, CCDC88A, CCDC92, CCDCl22, CCER2, CCNF, CCNL2, CCT6A, CD276, CD46, CDC25B, CDC40, CDC42BPA, CDCA7, CDHll, CDHI13, CDH18, CDH18, CDH18, CDH18, CDH18 CECR7, CELSRl, CEMIP, CENPI, CEP112, CEPl62, CEP170, CEP192, CEP68, CFH, CFLAR, CHD8, CHEK1, CHRM2, CIITA, CIZl, CLDN23, CLICl, CLK4, CLTA, CMAHP, CNGA4, CNOT1, CNRIPl, CNOT1, CNR1 CMSSl1, CNOT7, CNRIP1, CNTN1, COG1l,
[0085] [0085] In another specific aspect described here, the gene, or RNA transcript, is transcribed from a gene that is not SMN2.
[0086] [0086] In another specific aspect described here, the RNA gene or transcript is transcribed from a gene that is not selected from: ABHD10, ADAM12, AKTl, ANXAll, APLP2, APPL2, ARMCX6, ATG5, AXINl, BAIAP2, CCNBIIPl, CCT7, CEP57, CSFl, DLGAP4, EPN1l, ERGIC3, FOXMl, GGCT, GRAMD3, HSD1I7B4, LARP7, LRRC42, MADD, MANIBl, MRPL39, PCBP4, PPHLNlI, PRKACB, RAB6, SRAA, RAP6, RAP1,
[0087] [0087] In another specific aspect described here, the gene, or RNA transcript is transcribed from a gene that is not selected from: ABHD10, ADAM12, AKT1, ANXAl1, APLP2, APPL2, ARMCX6, ATG5, AXINlI, BAIAP2 , CCNBIlIP1, CCT7, CEP57, CSFl, DLGAP4, EPN1, ERGIC3, FOXMl, GGCT, GRAMD3, HSDI7B4, LARP7, LRRC42, MADD, MANIB1, MRPL39, PCBP4, PPHLN1, PRKACB, RABN, SRAN, RAPIA, and TNRC6A.
[0088] [0088] In another specific aspect described here, the gene, or RNA transcript, is transcribed from a gene that is SMN2.
[0089] [0089] In another specific aspect described here, the gene, or RNA transcript is transcribed from a gene that is selected from: ABHD1I0, ADAM12, AKTl, ANXAl1l, APLP2, APPL2, ARMCX6, ATG5, AXIN1I, BAIAP2, CCNB1lIP1, CCT7, CEP57, CSFl, DLGAP4, EPNl, ERGIC3, FOXMl, GGCT, GRAMD3, HSDI7B4, LARP7, LRRC42, MADD, MANIBl, MRPL39, PCBP4, PPHLNl, PRKACB, RABN1, RAPA, RABR, STR1, RAPA, STR1, RAPIA, RAPIA, RAPIA, RAPIA, RAPIA, RAPIA, RAPIA, RAPA, RAPIA, RAPIA, RAPIA, RAPIA, RAPA, RAPIA, RAPA, RAPA, RAPIA, RAPA, RAPA, RAPA, RAPA, RAPA, RAPA, RAPA, RAPA, RAPA, RAPA.
[0090] [0090] In another specific aspect described here, the gene, or RNA transcript is transcribed from a gene that is selected from: ABHD1I0, ADAM12, AKT1, ANXAll, APLP2, APPL2, ARMCX6, ATG5, AXINl, BAIAP2, CCNBIlIP1, CCT7, CEP57, CSFl, DLGAP4, EPN1, ERGIC3, FOXMl, GGCT, GRAMD3, HSDI7B4, LARP7, LRRC42, MADD, MANIB1, MRPL39, PCBP4, PPHLN1, PRKACB, RAB23, RAPN, SRI, R1 TNRC6A.
[0091] [0091] In one aspect, the invention provides a method of modulating the amount and modifying the type of a protein produced by a cell containing the artificial gene construct as described above, wherein the method comprises bringing the cell into contact with a compound of Formula (1) or a form thereof, where Formula (1) is: A and N — N (1) or a form thereof, where: W is CH = CH or S; x is CHo, CH (Cisalkyl), C (Cisalkyl) ', CH = CH, O, NRs or a bond;
[0092] [0092] In another aspect, the invention provides a method of modulating the amount and modifying the type of a protein produced by a cell containing the artificial gene construct as described above, wherein the method comprises bringing the cell into contact with a compound of Formula (I) or a form thereof, in which Formula (1) is selected from a compound of Formula (Ia) and Formula (Ib):
[0093] [0093] In a specific aspect, in the context of DNA, the nucleotide sequence encoding the intronic REMS comprises a sequence selected from the group consisting of ANGAgtrngn (SEQ ID NO: 1809), CNGAgtrngn (SEQ ID NO: 1810) , GNGAgtrngn (SEQ ID NO: 1811), TNGAgtrngn (SEQ ID NO: 1812), NAGAgtrngn (SEQ ID NO: 1813), NCGAgtrngn (SEQ ID NO: 1814), NGGAgtrngn (SEQ ID NO: 1815), NTGAgtrngn (SEQ ID NO: 1815), NTGAgtrngn (SEQ ID NO: 1815), NTGAgtrngn NO: 1816), AAGAgtrngn (SEQ ID NO: 1817), ACGAgtrngn (SEQ ID NO: 1818), AGGAgtrngn (SEQ ID NO: 1819), ATGAgtrngn (SEQ ID NO: 1820), CAGAgtrngn (SEQ ID NO: 1821), CCGAgtrngn (SEQ ID NO: 1822), CGGAgtrngn (SEQ ID NO: 1823), CTGAgtrngn (SEQ ID NO: 1824), GAGAgtrngn (SEQ ID NO: 1825), GCGAgtrngn (SEQ ID NO: 1826), GGGAgtrngn (SEQ ID NO : 1827), GTGAgtrngn (SEQ ID NO: 1828), TAGAgtrngn (SEQ ID NO: 1829), TCGAgtrngn (SEQ ID NO: 1830), TGGAgtrngn (SEQ ID NO: 1831) and TTGAgtrngn (SEQ ID NO: 1832), at that r is adenine or guanine and n or N is any nucleotide.
[0094] [0094] In one aspect, the invention provides a method for modifying RNA splicing to produce a mature mRNA transcript containing an iExon, wherein the method comprises bringing a pre-mRNA transcript into contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises at 5 'to 3' direction: a first 5 'splice site, a first branch point, a first 3' splice site, an intronic splicing modifier (iREMS) recognition element, a second branch point, and a second splice site 3 ', where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: As N — N (1) or a form of even, where: W is CH = CH or S;
[0095] [0095] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mMRNA transcript, wherein the method comprises placing the pre- mMRNA in contact with a compound of Formula (II) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an intronic splicing modifier (iREMS) recognition element, a branch point and a 3 'splice site, where iREMS comprises an RNA sequence
[0096] [0096] In a specific aspect of the previous aspect, the intron further comprises in the 5 "to 3 'direction: a splice site 5' a branching point and a splice site 3 'upstream of iREMS.
[0097] [0097] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mMRNA transcript, wherein the method comprises placing the pre- mMRNA in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises three exons and two introns, where three exons and two introns are in the following order from 5 "to 3": a first exon, a first intron, a second exon, a second intron and a third exon, where the first intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: a first 5 'splice site, a first branching point and a first 3 'splice site, wherein the second intron comprises a sequence of RNA nucleotides including, in the 5' to 3 "direction: a second 5 'splice site, a modifier recognition element intronic splicing (iREMS), a second branching point and a second splice site 3 ', in which iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: W. x TB N — N
[0098] [0098] In some respects, iREMS is an endogenous iREMS. In other respects, iREMS is a non-endogenous iREMS.
[0099] [0099] In another aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises at 5 'to 3 "direction: a first 5' splice site, a first branch point, a first 3 'splice site, an intronic splicing modifier (iREMS) recognition element, a second branch point, and a second 3 'splice site, in which iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, where the pre-mRNA transcript is a pre-mRNA transcript of a gene that is selected from the genes listed in a table at present, and the Fór mule (1) is:
[00100] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mMRNA transcript produced by a pre-mMRNA transcript, wherein the method comprises placing the pre-mRNA transcript mMRNA in contact with a compound of Formula (II) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an intronic splicing modifier (iREMS) recognition element, a branch point and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, where the pre-mRNA transcript is a pre-mRNA transcript of a gene that is selected from the genes listed in a table in the present, and Formula (1) is: W.
[00101] [00101] In a specific aspect of the previous aspect, the intron also comprises in the 5 'to 3' direction: a 5 'splice site,
[00102] [00102] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript, wherein the method comprises placing the pre-MRNA transcript mMRNA in contact with a compound of Formula (II) or a form thereof, in which the pre-mRNA transcript comprises three exons and two introns, where three exons and two introns are in the following order from 5 ° to 3 ": one first exon, a first intron, a second exon, a second intron and a third exon, wherein the first intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: a first 5 'splice site, a first branch point and a first 3 'splice site, wherein the second intron comprises a sequence of RNA nucleotides including, in the 5' to 3 "direction: a second 5 'splice site, a modifier recognition element intronic splicing (iREMS), a second branching point and a second 3 'splice site, in which the iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, where the pre-mRNA transcript is a pre-mRNA transcript of a gene that is selected from among the genes listed in a table at present, with Formula (1) being: As N — N (1) or a form thereof, where: W is CH = CH or S;
[00103] [00103] In another aspect, the invention provides a method for modifying RNA splicing in order to produce a mature MRNA transcript containing an iExon, wherein the method comprises placing a pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises at 5 'to 3' direction: a first splice site 5 ', a first branch point, a first splice site 3 ", an intronic splicing modifier (iREMS) recognition element, a second branch point and a second splice site 3 ', where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being:
[00104] [00104] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mMRNA transcript, wherein the method comprises placing the pre-mRNA transcript mMRNA in contact with a compound of Formula (II) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3 "direction: an intronic splicing modifier (iREMS) recognition element, a branch point and a 3' splice site, where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: W.
[00105] [00105] In a specific aspect of the previous aspect, the intron also comprises in the 5 'to 3' direction: a splice site 5 ',
[00106] [00106] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript, wherein the method comprises placing the pre- mMRNA in contact with a compound of Formula (II) or a form thereof, in which the pre-mRNA transcript comprises three exons and two introns, where three exons and two introns are in the following order from 5 ° to 3 ": one first exon, a first intron, a second exon, a second intron and a third exon, wherein the first intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: a first 5 'splice site, a first branch point and a first 3 'splice site, wherein the second intron comprises a sequence of RNA nucleotides including, in the 5' to 3 "direction: a second 5 'splice site, a modifier recognition element intronic splicing (iREMS), a second branching point and a second splice site 3 ', where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: A and N — N (1 ) or a form thereof, where: W is CH = CH or S; xXx is CHo, CH (Cisalkyl), C (Cisalkyl), ', CH = CH, O, NRs or a bond;
[00107] [00107] In a specific aspect, the pre-mRNA transcript is in a cell or a cell lysate and the method comprises bringing the compound into contact with the cell or the cell lysate. In a specific aspect, the method modulates the amount and / or modifies the type of a protein produced from the mature mRNA transcript and produced in the cell or in the cell lysate.
[001080] [001080] In a specific aspect, the method comprises administering the compound to an individual. In a specific aspect, the method modulates the amount and / or modifies the type of a protein produced from the mature mMRNA transcript and produced in the individual. In one aspect, the individual is not human. In another aspect, the individual is human.
[00109] [00109] In a specific aspect, the mature mRNA transcript encodes a detectable reporter protein.
[00110] [00110] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent or treat a disease or disorder in which a variation in the level of expression of one, two, three or more RNA isoforms encoded by a gene is beneficial for the prevention or treatment of the disease, in which the method comprises administering a compound described herein to an individual who needs it, in which one, two, three or more of the RNA isoforms are produced by modifying the RNA splicing of a pre-mRNA transcript comprising two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 'to 3' direction: a first splice site 5 ", a first branching point, a first splice site 3 ', an intronic splicing modifier recognition element (iREMS), a second branching point and a second splice site 3', in which the iREMS comprises a sequence of R NA GAgurngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: W. x TB N — N
[00111] [00111] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent or treat a disease or disorder in which a variation in the level of expression of one, two, three or more isoforms of RNA encoded by a gene is beneficial for the prevention or treatment of the disease, in which the method comprises administering a compound described herein to an individual who needs it, in which one, two, three or more of the RNA isoforms are produced from a transcript of pre-mRNA comprising two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a nucleotide sequence of the RNA including, in the 5 'to 3' direction : an intronic splicing modifier (iREMS) recognition element, a branch point and a 3 'splice site, in which iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, being that Formula (1) is: W.,
[00112] [00112] In a specific aspect of the previous aspect, the intron further comprises in the 5 'to 3' direction: a 5 'splice site, a branch point and a 3' splice site upstream of iREMS.
[00113] [00113] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent or treat a disease or disorder in which a variation in the level of expression of one, two, three or more RNA isoforms encoded by a gene is beneficial for the prevention or treatment of the disease, in which the method comprises administering a compound described herein to an individual who needs it, in which one, two, three or more of the RNA isoforms are produced from a transcript of pre-mRNA comprising three exons and two introns, where three exons and two introns are in the following order from 5 'to 3': a first exon, a first intron, a second exon, a second intron and a third exon, where the first intron comprises a sequence of RNA nucleotides including, in the 5 to 3 'direction: a first splice site 5', a first branching point and a first splice site 3 ', where the second intron comprises a sequence of RNA nucleotides including, in the 5 "to 3 'direction: a second splice site 5', an intronic splicing modifier (iREMS) recognition element, a second branch point and a second splice site 3 ', in which iREMS comprises a sequence of GAgurngn RNA, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: W.,
[00114] [00114] In some respects, iREMS is an endogenous iREMS. In other respects, iREMS is a non-endogenous iREMS.
[00115] [00115] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence including exons and one or more introns, wherein at least one intron comprises an iREMS which is downstream of a branch point and a site of splice 3 ', iREMS comprising the sequence GAgurngn, where r is adenine or guanine and n is any nucleotide.
[00116] [00116] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence including two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which The nucleotide sequence of the intron RNA comprises in the 5 'to 3' direction: a first 5 'splice site, a first branching site, a first 3' splice site, an iREMS, a second branching site and a second site 3 'splice, wherein the iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide.
[00117] [00117] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence including two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which the The intron RNA nucleotide sequence comprises in the 5 'to 3 "direction: an iREMS, a branching point and a 3' splice site, where the iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and en is any nucleotide.
[00118] [00118] In another aspect, the invention provides a cell that comprises an artificial gene construct described herein.
[00119] [00119] In a specific aspect, iREMS comprises a GAguragu RNA sequence, where r is adenine or guanine.
[00120] [00120] In another specific aspect, iREMS comprises an NNGAgurngn RNA sequence (SEQ ID NO: 1), where r is adenine or guanine and n or N is any nucleotide. In a specific aspect, the NNGAgurngn RNA sequence (SEQ ID NO: 1) is selected from the group consisting of ANGAgurngn (SEQ ID NO: 4), CNGAgurngn (SEQ ID NO: 5), GNGAgurngn (SEQ ID NO: 6), UNGAgurngn (SEQ ID NO: 7), NAGAgurngn (SEQ ID NO: 8), NCGAgurngn (SEQ ID NO: 9), NGGAgurngn (SEQ ID NO: 10), NUGAgurngn (SEQ ID NO: 11), AAGAgurngn ( SEQ ID NO: 12), ACGAgurngn (SEQ ID NO: 13), AGGAQurngn (SEQ ID NO: 14), AUGAgurngn (SEQ ID NO: 15), CAGAgurngn (SEQ ID NO: 16), CCGAgurngn (SEQ ID NO: 17) ), CcGGAgurngn (SEQ ID NO: 18), CUGAgurngn (SEQ ID NO: 19), GAGAgurngn (SEQ ID NO: 20), GCGAgurngn (SEQ ID NO: 21) GGGAgurngn (SEQ ID NO: 22), GUGAgurngn (SEQ ID NO: 22) NO: 23), UAGAgurngn (SEQ ID NO: 24), UCGAgurngn (SEQ ID NO: 25), UGGAgurngn (SEQ ID NO: 52) and UUÚGAgurngn (SEQ ID NO: 53), where r is adenine or guanine en or N is any nucleotide.
[00121] [00121] In another specific aspect, iREMS comprises an NNGAguragu RNA sequence (SEQ ID NO: 2), where r is adenine or guanine and N is any nucleotide. In a specific aspect, the NNGAguragu RNA sequence (SEQ ID NO: 2) is selected from the group consisting of ANGAguragu (SEQ ID NO: 28),
[00122] [00122] In certain respects, n is adenine or guanine.
[00123] [00123] In one aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mRNA transcript containing an iExon, wherein the method comprises placing a pre-mRNA transcript, produced from a sequence of DNA, in contact with a compound of Formula (II) or a form thereof, in which the DNA sequence encodes two exons and an intron, in which the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence that encodes the intron comprises in the 5 'to 3' direction: a sequence of nucleotides that encodes a first 5 'splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3' splice site, a nucleotide sequence that encodes u an intronic splicing modifier (iREMS) recognition element, a nucleotide sequence encoding a second branch point and a nucleotide sequence encoding a second 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: W.
[00124] [00124] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript that is produced by a DNA sequence, in which the The method comprises placing the pre-mRNA transcript produced from the DNA sequence in contact with a compound of Formula (1) or a form thereof, in which the DNA sequence encodes two exons and an intron, in which the sequence of nucleotides encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, wherein the nucleotide sequence encoding the intron comprises a DNA nucleotide sequence including, in the 5 'to 3' direction: a nucleotide sequence that encodes an intronic splicing modifier recognition element (iREMS), a nucleotide sequence encoding a branching point and a nucleotide sequence encoding a 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, that Formula (1) is: W.
[00125] [00125] In a specific aspect of the previous aspect, the nucleotide sequence that encodes the intron further comprises in the 5 'to 3 "direction: a nucleotide sequence that encodes a 5' splice site, a nucleotide sequence that encodes a point branching and a nucleotide sequence encoding a 3 'splice site upstream of the nucleotide sequence encoding iREMS.
[00126] [00126] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mMRNA transcript that is produced by a DNA sequence, in which the The method comprises placing the pre-mRNA transcript produced from the DNA sequence in contact with a compound of Formula (I) or a form thereof, in which the DNA sequence encodes three exons and two introns, in which the sequences of nucleotides encoding the three exons and the two introns, respectively, are in the following order from 5 "to 3": a sequence of nucleotides that encodes a first exon, a sequence of nucleotides that encodes a first intron, a sequence of nucleotides that encodes a second exon, a nucleotide sequence that encodes a second intron and a nucleotide sequence that encodes a third exon, wherein the nucleotide sequence that encodes the first intron comprises a sequence of DNA nucleotides including, in the 5 'to 3' direction: a nucleotide sequence that encodes a first splice site 5 ', a nucleotide sequence that encodes a first branch point and a nucleotide sequence that encodes a first splice site 3 ', wherein the nucleotide sequence encoding the second intron comprises a DNA nucleotide sequence including, in the 5' to 3 "direction: a nucleotide sequence encoding a second 5" splice site, a sequence of nucleotides that encodes an intronic splicing modifier (iREMS) recognition element, a nucleotide sequence that encodes a second branch point and a nucleotide sequence that encodes a second 3 'splice site, wherein the nucleotide sequence that encodes iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being:
[00127] [00127] In some respects, the nucleotide sequence that encodes iREMS is a nucleotide sequence that encodes an endogenous iREMS. In other respects, the nucleotide sequence that encodes iREMS is a nucleotide sequence that encodes a non-endogenous iREMS.
[00128] [00128] In another aspect, the invention provides a method for modifying RNA splicing in order to produce a mature MRNA transcript containing an iExon, wherein the method comprises placing a pre-mRNA transcript, produced from a sequence of DNA, in contact with a compound of Formula (IL) or a form thereof, in which the DNA sequence encodes two exons and an intron, in which the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence that encodes the intron comprises in the 5 'to 3' direction: a sequence of nucleotides that encodes a first 5 'splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3' splice site, a nucleotide sequence that encodes an endogenous intronic splicing modifier (iREMS) recognition element, a nucleotide sequence encoding a second branch point and a nucleotide sequence encoding a second splice 3 'site, wherein the nucleotide sequence encoding the iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the DNA sequence is the DNA sequence of a gene that is selected from the genes listed in a table at present, the Formula (1) is:
[00129] [00129] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript that is produced by a DNA sequence, in which the The method comprises placing the pre-mRNA transcript produced from the DNA sequence in contact with a compound of Formula (I) or a form thereof, in which the DNA sequence encodes two exons and an intron, in which the sequence of nucleotides encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, wherein the nucleotide sequence encoding the intron comprises a DNA nucleotide sequence including, in the 5 'to 3' direction: a nucleotide sequence that encodes an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a s nucleotide equation encoding a branch point and a nucleotide sequence encoding a 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the DNA sequence is the DNA sequence of a gene that is selected from among the genes listed in a table at present, with Formula (1) being:
[00130] [00130] In a specific aspect of the previous aspect, the nucleotide sequence that encodes the intron further comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a splice site 5 ', a sequence of nucleotides that encodes a point branching and a nucleotide sequence encoding a 3 'splice site upstream of the nucleotide sequence encoding iREMS.
[00131] [00131] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript that is produced by a DNA sequence, in which the The method comprises placing the pre-mRNA transcript produced from the DNA sequence in contact with a compound of Formula (1) or a form thereof, in which the DNA sequence encodes three exons and two introns, in which the sequences of nucleotides encoding the three exons and the two introns, respectively, are in the following order from 5 'to 3': a nucleotide sequence that encodes a first exon, a nucleotide sequence that encodes a first intron, a sequence of nucleotides that encodes a second exon, the nucleotide sequence that encodes a second intron and a nucleotide sequence that encodes a third exon, wherein the nucleotide sequence that encodes the first intron comprises a nucleotide sequence DNA leotides including, in the 5 'to 3' direction: a nucleotide sequence that encodes a first splice site 5 ', a nucleotide sequence that encodes a first branch point and a nucleotide sequence that encodes a first splice site 3 ', wherein the nucleotide sequence encoding the second intron comprises a DNA nucleotide sequence including, in the 5' to 3 'direction: a nucleotide sequence encoding a second 5' splice site, a nucleotide sequence that encodes an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a nucleotide sequence encoding a second branch point and a nucleotide sequence encoding a second splice 3 'site, in which the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the DNA sequence is the DNA sequence of a gene that is selected from the genes listed in a table at present, with Formula (1) being:
[00132] [00132] In another aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a pre-mRNA transcript, produced from a sequence of DNA, in contact with a compound of Formula (1) or a form thereof, in which the DNA sequence encodes two exons and an intron, in which the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence that encodes the intron comprises in the 5 'to 3' direction: a sequence of nucleotides that encodes a first 5 'splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3 "splice site, a nucleotide sequence that encodes a non-endogenous intronic splicing modifier (iREMS) recognition element, a nucleotide sequence encoding a second branch point and a nucleotide sequence encoding a second splice 3 'site, in which the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: W. x TB N — N
[00133] [00133] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript that is produced by a DNA sequence, in which the The method comprises placing the pre-mRNA transcript produced from the DNA sequence in contact with a compound of Formula (I) or a form thereof, in which the DNA sequence encodes two exons and an intron, in which the sequence of nucleotides encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, wherein the nucleotide sequence encoding the intron comprises a DNA nucleotide sequence including, in the 5 'to 3' direction: a nucleotide sequence that encodes an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a s nucleotide equation encoding a branch point and a nucleotide sequence encoding a 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being:
[00134] [00134] In a specific aspect of the previous aspect, the nucleotide sequence that encodes the intron further comprises in the 5 'to 3 "direction: a nucleotide sequence that encodes a 5' splice site, a nucleotide sequence that encodes a point branching and a nucleotide sequence encoding a 3 'splice site upstream of iREMS.
[00135] [00135] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript that is produced by a DNA sequence, in which the The method comprises placing the pre-mRNA transcript produced from the DNA sequence in contact with a compound of Formula (1) or a form thereof, in which the DNA sequence encodes three exons and two introns, in which the sequences of nucleotides that encode the three exons and the two introns, respectively, are in the following order of 5 '/ to 3 ": a sequence of nucleotides that encodes a first exon, a sequence of nucleotides that encodes a first intron, a sequence of nucleotides that encodes a second exon, a nucleotide sequence that encodes a second intron and a nucleotide sequence that encodes a third exon, wherein the nucleotide sequence that encodes the first intron comprises a sequence of DNA nucleotides including, in the 5 'to 3' direction: a nucleotide sequence that encodes a first splice site 5 ', a nucleotide sequence that encodes a first branch point and a nucleotide sequence that encodes a first splice site 3 ', wherein the nucleotide sequence encoding the second intron comprises a DNA nucleotide sequence including, in the 5' to 3 'direction: a nucleotide sequence encoding a second 5 "splice site, a sequence of nucleotides that encodes an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a nucleotide sequence encoding a second branch point and a nucleotide sequence encoding a second splice 3 'site, in which the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being:
[00136] [00136] In a specific aspect, the pre-mRNA transcript is in a cell or a cell lysate and the method comprises bringing the compound into contact with the cell or the cell lysate. In a specific aspect, the method modulates the amount and / or modifies the type of a protein produced from the mature mRNA transcript and produced in the cell or in the cell lysate.
[00137] [00137] In a specific aspect, the method comprises administering the compound to an individual. In a specific aspect, the method modulates the amount and / or modifies the type of a protein produced from the mature mMRNA transcript and produced in the individual. In one aspect, the individual is not human. In another aspect, the individual is human.
[00138] [00138] In a specific aspect, the mature mRNA transcript encodes a detectable reporter protein.
[00139] [00139] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent or treat a disease or disorder in which a variation in the level of expression of one, two, three or more RNA isoforms encoded by a gene is beneficial for the prevention or treatment of the disease, in which the method comprises administering a compound described herein to an individual who needs it, in which one, two, three or more of the RNA isoforms are produced from a transcript of pre-mRNA that is produced from a DNA sequence that encodes two exons and an intron, where the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleon sequence that encodes the intron, where the nucleotide sequence that encodes the intron comprises in the 5 '/ 3' direction: a nucleotide sequence that encodes a first 5 'splice uncle, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3' splice site, a nucleotide sequence that encodes an intronic splicing modifier recognition element (iREMS) , a nucleotide sequence that encodes a second branching point and a nucleotide sequence that encodes a second 3 'splice site, wherein the nucleotide sequence that encodes iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine en is any nucleotide, with Formula (1) being: W. oÇs N — N
[00140] [00140] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent or treat a disease or disorder in which a variation in the level of expression of one, two, three or more RNA isoforms encoded by a gene is beneficial for the prevention or treatment of the disease, in which the method comprises administering a compound described herein to an individual who needs it, in which one, two, three or more of the RNA isoforms are produced from a transcript of pre-mRNA that is produced from a DNA sequence that encodes two exons and an intron, where the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleon sequence encoding the intron, wherein the nucleotide sequence encoding the intron comprises a DNA nucleotide sequence including, in the 5 'to 3' direction: a sequence nucleotide encoding an intronic splicing modifier recognition element (iREMS), a nucleotide sequence encoding a branch point, and a nucleotide sequence encoding a 3 'splice site, where the nucleotide sequence that encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, with Formula (1) being: WO XxX Is N — N
[00141] [00141] In a specific aspect of the previous aspect, the nucleotide sequence that encodes the intron further comprises in the 5 'to 3 "direction: a nucleotide sequence that encodes a 5' splice site, a nucleotide sequence that encodes a point branching and a nucleotide sequence encoding a 3 'splice site upstream of the nucleotide sequence encoding iREMS.
[00142] [00142] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent or treat a disease or disorder in which a variation in the level of expression of one, two, three or more isoforms of RNA encoded by a gene is beneficial for the prevention or treatment of the disease, in which the method comprises administering a compound described herein to an individual who needs it, in which one, two, three or more of the RNA isoforms are produced from a transcript of P-pre-mRNA that is produced from a DNA sequence that encodes three exons and two introns, in which the nucleotide sequences that encode the three exons and the two introns,
[00143] [00143] In some respects, the nucleotide sequence that encodes iREMS is an endogenous nucleotide sequence that encodes iREMS. In other respects, the nucleotide sequence that encodes iREMS is a non-endogenous nucleotide sequence that encodes iREMS.
[00144] [00144] In another aspect, the invention provides an artificial gene construct comprising a DNA sequence encoding exons and one or more introns, wherein the nucleotide sequence encoding at least one intron comprises a nucleotide sequence encoding an iREMS that is downstream of a nucleotide sequence encoding a branch point and a nucleotide sequence encoding a 3 'splice site, the nucleotide sequence encoding iREMS comprising the GAgtrngn sequence, where r is adenine or guanine and any nucleotide.
[00145] [00145] In another aspect, the invention provides an artificial gene construct comprising a DNA sequence that encodes two exons and an intron, wherein the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the DNA that encodes the intron comprises in the 5 'to 3' direction: a sequence of nucleotides that encodes a first 5 "splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3 'splice site, a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a second point branching sequence and a nucleotide sequence encoding a second 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises and a GAgtrngn DNA sequence, where r is adenine or guanine and n is any nucleotide.
[00146] [00146] In another aspect, the invention provides an artificial gene construct comprising a DNA sequence that encodes two exons and an intron, wherein the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, where the nucleotide sequence of the DNA encoding the intron comprises in the 5 'to 3 "direction: a nucleotide sequence encoding an iREMS ,
[00147] [00147] In another aspect, the invention provides a cell that comprises an artificial gene construct described herein.
[00148] [00148] In a specific aspect, the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtragu, where r is adenine or guanine.
[00149] [00149] In another specific aspect, the nucleotide sequence encoding iREMS comprises a DNA sequence NNGAgtrngn (SEQ ID NO: 1808), where r is adenine or guanine and n or N is any nucleotide. In a specific aspect, the DNA sequence NNGAgtrngn (SEQ ID NO: 1808) is selected from the group consisting of ANGAgtrngn (SEQ ID NO: 1809), CNGAgtrngn (SEQ ID NO: 1810), GNGAgtrngn (SEQ ID NO: 1811), TNGAgtrngn (SEQ ID NO: 1812), NAGAgtrngn (SEQ ID NO: 1813), NCGAgtrngn (SEQ ID NO: 1814), NGGAgtrngn (SEQ ID NO: 1815), NTGAgtrngn (SEQ ID NO: 1816), AAGAgtrngn ( SEQ ID NO: 1817), ACGAgtrngn (SEQ ID NO: 1818), AGGAgtrngn (SEQ ID NO: 1819), ATGAgtrngn (SEQ ID NO: 1820), CAGAgtrngn (SEQ ID NO: 1821), CCGAgtrngn (SEQ ID NO: 1822 ), CGGAgtrngn (SEQ ID NO: 1823), CTGAgtrngn (SEQ ID NO: 1824), GAGAgtrngn (SEQ ID NO: 1825), GCGAgtrngn (SEQ ID NO: 1826), GGGAgtrngn (SEQ ID NO: 1827), GTGAgtrngn (SEQ ID NO: 1827), GTGAgtrngn ID NO: 1828), TAGAgtrngn (SEQ ID NO: 1829), TCGAgtrngn (SEQ ID NO: 1830), TGGAgtrngn (SEQ ID NO: 1831) and TTGAgtrngn (SEQ ID NO: 1832), where r is adenine or guanine en or N is any nucleotide.
[00150] [00150] In another specific aspect, the nucleotide sequence encoding iREMS comprises a DNA sequence NNGAgtragu (SEQ ID NO: 3609), where r is adenine or guanine and N is any nucleotide. In a specific aspect, the DNA sequence NNGAgtragu (SEQ ID NO: 3609) is selected from the group consisting of ANGAgtragu (SEQ ID NO: 3610), CNGAgtragu (SEQ ID NO: 3611), GNGAgtragu (SEQ ID NO: 3612), TNGAgtragu (SEQ ID NO: 3613), NAGAgtragu (SEQ ID NO: 3614), NCGAgtragu (SEQ ID NO: 3615), NGGAgtragu (SEQ ID NO: 3616), NTGAgtragu (SEQ ID NO: 3617), AAGAgtragu ( SEQ ID NO: 3618), ACGAgtragu (SEQ ID NO: 3619), AGGAgtragu (SEQ ID NO: 3620), ATGAgtragu (SEQ ID NO: 3621), CAGAgtragu (SEQ ID NO: 3622), CCGAgtragu (SEQ ID NO: 3623) ), CGGAgtragu (SEQ ID NO: 3624), CTGAgtragu (SEQ ID NO: 3625), GAGAgtragu (SEQ ID NO: 3626), GCGAgtragu (SEQ ID NO: 3627), GGGAgtragu (SEQ ID NO: 3628), GTGAgtragu (SEQ ID NO: 3629), TAGAgtragu (SEQ ID NO: 3630), TCGAgtragu (SEQ ID NO: 3631), TGGAgtragu (SEQ ID NO: 3632) and TTGAgtragu (SEQ ID NO: 3633), where r is adenine or guanine, and N is any nucleotide.
[00151] [00151] In certain respects, n is adenine or guanine.
[00152] [00152] In a specific aspect, the pre-mRNA transcript described here is a pre-mRNA transcript of a gene that is not selected from: ABHD10, ADAM12, AKT1l, ANXAll, APLP2, APPL2, ARMCX6, ATG5, AXINl, BAIAP2, CCNBI1IP1, CCT7, CEP57, CSFl, DLGAP4, EPNl, ERGIC3, FOXMl, GGCT, GRAMD3, HSD1I7B4, LARPT7, LRRC42, MADD, MANIBl, MRPL39, PCBP4, PPHLNl, RAC, PRHLN, SREKl, STRN3 and TNRCG6A.
[00153] [00153] Figures 1A-1C. Schematic drawings representative of intronic exon splicing mediated by an intronic REMS, where
[00154] [00154] Figures 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B and 6A. Dose-dependent production of iExons in SH-SY5Y cells, treated for 20 hours with a compound described herein, is shown for certain genes in Figures 2A, 2B, 3A, 3B, 4A, 4B. Dose-dependent production of iExons in GMO4856 cells, treated for 20 hours with a compound described herein, is shown for certain genes in Figures 5A and 5B. The dose-dependent production of iExons in SH-SY5Y cells, treated for 20 hours with a compound described here, is shown for the ELMO2 gene in Figure 6A. For each Figure, RT-PCR of the total RNA endpoint showed the resulting bands of interest for each gene, as indicated by light and dark arrowheads, in which a light arrowhead represents an exon isoform in the event of an endogenous splicing the wild type; and, where a dark arrowhead represents an exon isoform containing an iExon included in the mRNA. In all cases, an increase in the concentration of the compound resulted in the appearance of a slower migrating PCR product, containing the derived intronic exon, in which the additional bands seen are intermediate processed products of the splicing. The asterisk (*), in some Figures, represents an event in which the targeted exon has been omitted (skipped). Thus, the result for each gene demonstrates a statistically significant splicing event that represents various aspects of the operation of an intronic REMS in combination with splicing modifying compounds as described here.
[00155] [00155] Figures 6B and 6C. The production of certain intronic exon isoforms in the presence of one or more compounds described here is shown for ELMO2 in these schematic drawings, where the presence of each isoform demonstrates a statistically significant splicing event that represents various aspects of the interactions of an intronic REMS sequence , where one or more branch points and one or more 3 "splice sites are shown in the presence of compounds as described herein.
[00156] [00156] In one aspect, the invention provides an intronic splicing modifier recognition element (otherwise referred to as "iREMS") having elements capable of being recognized by a small splicing modifying molecule, in which the elements of the complex associated with iREMS, in combination with the small modifying splicing molecule, affect interactions with the spliceosome as described in more detail below. In a specific aspect, the intronic REMS has the nucleotide sequence GAgurngn at the RNA level, where r is A or G (that is, adenine or purine nucleotide guanine) and n is any nucleotide. In another specific aspect, the intronic REMS has the nucleotide sequence GAguragu at the RNA level, where r is adenine or guanine. In one or more of the specific aspects defined above, n is adenine or guanine.
[00157] [00157] In the context of DNA, in a specific aspect, the nucleotide sequence encoding an intronic REMS has the sequence Gagtrngn, where r is A or G (ie adenine or purine nucleotide guanine) and n is any nucleotide. In another specific aspect, in the context of DNA, the nucleotide sequence encoding an intronic REMS has the Gagtragt sequence, where r is adenine or guanine. In a specific aspect, in the context of DNA, the nucleotide sequence encoding an intronic REMS has the sequence NNGAgtrngn (SEQ ID NO: 1808), where r is A or G (ie adenine or purine nucleotide guanine) en or N is any nucleotide. In another specific aspect, in the context of DNA, the nucleotide sequence encoding an intronic REMS has the sequence NNGAgtragt (SEQ ID NO: 3634), where r is adenine or guanine and N is any nucleotide. In a specific aspect, in the context of
[00158] [00158] An intronic REMS can be part of an endogenous RNA or can be introduced into an RNA sequence that does not naturally contain the intronic REMS sequence (in which case, the intronic REMS introduced is a non-endogenous intronic REMS, that is, an intronic REMS not naturally present in the corresponding RNA A nucleotide sequence encoding an intronic REMS may also be part of an endogenous DNA sequence, or a nucleotide sequence encoding the intronic REMS may be introduced into a DNA sequence that is not naturally contains the nucleotide sequence that encodes an intronic REMS.
[00159] [00159] In a specific aspect, REMS is located in an intron and is upstream of a branching point and a functional 3 'splice site, which, in the presence of a small splicing modifying molecule, allows REMS function as a 5 'splice site. Without being bound by any theory or mechanism, the small molecule compounds described here have been shown to increase the affinity of the interaction between Ul snRNP, as well as other components of the pre-mRNA splicing machinery, and the REMS NNGA nucleotides, whereby, in the presence of the compound, the intronic REMS functions as a binding site for Ul snRNP, causing the intronic nucleotides to be processed as an intronic exon.
[00160] [00160] In one aspect, the invention provides compounds of Formula (1) for use in the methods described herein:
[00161] [00161] In another aspect the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Tb) for use in the methods described herein: AY IA, N = N 4 NA 8 (Ia) (1b) or a form thereof, where:
[00162] [00162] In another aspect the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described here: A Yx IA,
[00163] [00163] In another aspect the invention provides compounds of Formula (1) for use in the methods described herein, wherein the compound of Formula (I) is selected from a compound of Formula (ITall), Formula (Ial5), Formula (Ial8) or Formula (Ibl): x FP
[00164] [00164] Another aspect of the present description relates to a compound of Formula (I) selected from a compound of Formula (Iall), Formula (Ial5), Formula (Ial8) or Formula (Ibl1): or a form the same, where (when present), Ria is selected from fluoro, chloro, hydroxyl, methyl, difluoromethyl, amino, methoxy or lH-pyrazolyl or l1H-imidazol-l-ila,
[00165] [00165] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial) or a form thereof , where the substituents Ria, Rw and X, when present, are indicated in the table below with multiple substituents separated by a comma; and “-” indicates that one or more substituents Ria, RwW and X are not present: * x  | N NH í TWO IN Ria 6 Prá XK 1 Ri (Ial) [opposite | A [e [x | oa [= == | = | x | [ao] 1cmenem, 2208 | - | nor,
[00166] [00166] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia2) or a form thereof , where the substituents Ria, Riww and R4aa, when present, are indicated in the table below with multiple substituents separated by a comma; and “-” indicates that one or more substituents Ria, Riww and Ra are not present:
[00167] [00167] In another aspect the invention provides compounds of Formula (Ta) or a form thereof for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ta3i) or a form thereof, in that substituents Ria, Riww and X, when present, are indicated in the table below with multiple substituents separated by a comma; and, "" "-" indicates that one or more Ria, Rw and X substituents are not present: SN x Ria | N NH Ss if NODE
[00168] [00168] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia4) or a form thereof , where the substituents X, Ria, Rir and € Ra, when present, are indicated in the table below; and “-” indicates that one or more substituents X, Riar Rio E Ra are not present: x
[00169] [00169] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia5) or a form thereof , where the substituents Ria and Rir, when present, are indicated in the table below with multiple substituents separated by a comma; and “-” indicates that one or more Ria and Riw substituents are not present: N
[00170] [00170] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia6) or a form thereof , where the Ria substituents, when present, are indicated in the table below; and “-” indicates that one or more Ria substituents are not present: Pa N j | SW AN NH RiaT 7 0 & N oH (Ia6) Ch, [a e
[00171] [00171] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia7) or a form thereof , where the Ria substituents, when present, are indicated in the table below; and “-” indicates that one or more Ria substituents are not present: N
[00172] [00172] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia8) or a form thereof , where the Ri substituents. and B, when present, are indicated in the table below; and “-” indicates that one or more substituents Ria and B are not present: B
[00173] [00173] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ia9) or a form thereof , where the substituents Ria and B, when present, are indicated in the table below; and “-” indicates that one or more substituents Ria and B are not present: B
[00174] [00174] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (TIalo0) or a form thereof , where the Ri substituents. and B, when present, are indicated in the table below; and “-” indicates that one or more substituents Ria and B are not present:
[00175] [00175] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Iall) or a form thereof , where the substituents A, X and Ri, when present, are indicated in the table below; and "-" indicates that one or more substituents A, X and Rai. are not present:
[00176] [00176] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (TIall) or a form thereof , where substituents A, X and Riu, when present, are indicated in the table below; and “-” indicates that one or more substituents A, X and Ra: are not present: XL R SW N NH
[00177] [00177] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Iall) or a form thereof , where the substituents A, X and Ri, when present, are indicated in the table below; and "-" indicates that one or more substituents A, X and Ri. are not present: es AN SW "the NH (Tall) [eee a [x [am [ose Fe | res [as | Gum mepiresmenem | rem | [am | pluck | o [65 | Romanian - [6 [am | rcomeremen | o [as [momemermENeATT | o [o Ameno [es] [am | O rama | res [as [O nes [e [a O ape [o [as TO maomennmeent - | o | [am | Romanian | o ee AO [a | ompememe | e [66 [rms mea | o [ao | cmsperamenA | o | e | amem | | 451 il] fenil [5 | meme | res | [as [O romeo - [e [ae [see een ) o | [as [O menmen [e] and | EE | | 457 il) pyrimidin-4-1il [as | Gore [o [a | rromreeeeenEem | o |
[00178] [00178] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial2) or a form thereof , where the substituents X, Riwa and B, when present, are indicated in the table below; and “-” indicates that one or more substituents X, Ria and B are not present: Z X “xg Riz oH (ITal2) [eme Ja pos [6 TE De DO ses
[00179] [00179] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial3) or a form thereof , where the substituents X, Ria and Ria, when present, are indicated in the table below; and "-" indicates that one or more substituents X, Ria and Ra. are not present: PD X
[00180] [00180] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial4) or a form thereof , where the substituents X and B, when present, are indicated in the table below; and “-” indicates that one or more substituents X and B are not present: Z * xg CT oH == N (Ial4)
[00181] [00181] In another aspect the invention provides compounds of Formula (Ta), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial5) or a form thereof , where the substituents X, Ria and Ri, when present, are indicated in the table below; and "-" indicates that one or more substituents X, Ria and Ra. are not present:
[00182] [00182] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial5) or a form thereof , where the substituents X, Ria and Ra, when present, are indicated in the table below; and "-" indicates that one or more substituents X, Ria and Rai. are not present:
[00183] [00183] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Tal6) or a form thereof , in which the substituents Ria E R1a2, when present, are indicated in the table below; and “-” indicates that one or more Ria and Ria substituents are not present:
[00184] [00184] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial7) or a form thereof , where the substituent Ria, when present, is indicated in the table below; and “-” indicates that one or more Ria substituents are not present: SW o Riz oH (ITal7) am [meme |
[00185] [00185] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial8) or a form thereof , where the substituents X and B, when present, are indicated in the table below; and “-” indicates that one or more substituents X and B are not present:
[00186] [00186] In another aspect the invention provides compounds of Formula (Ia), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ial8) or a form thereof , where the substituents X, Rwa and B, when present, are indicated in the table below; and “-” indicates that one or more substituents X, Ria and B are not present:
[00187] [00187] In another aspect the invention provides compounds of Formula (Ib), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ibl) or a form thereof , where substituent A is indicated in the table below:
[00188] [00188] In another aspect the invention provides compounds of Formula (Tb), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ibl) or a form thereof , where substituent A is indicated in the table below: [eme | the [om were
[00189] [00189] In another aspect the invention provides compounds of Formula (Tb), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ibl) or a form thereof , where substituent A is indicated in the table below: A W / N — N
[00190] [00190] In another aspect the invention provides compounds of Formula (Ib), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib2) or a form thereof , where OO substituent A is indicated in the table below:
[00191] [00191] In another aspect the invention provides compounds of Formula (TIb), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib3) or a form thereof , where the substituents Ria, Rww and B, when present, are indicated in the table below; and “-” indicates that one or more substituents Ria, Rir and B are not present:
[00192] [00192] In another aspect the invention provides compounds of Formula (Ib), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib4) or a form thereof , in which the substituents Ria, Rir, Ric, Riad (each representative of the scope of Ri) and X, when present, are indicated in the table below; and “—--” indicates that one or more substituents Ria, Rip, Ric, Ria E X are not present:
[00193] [00193] In another aspect the invention provides compounds of Formula (Ib), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib5) or a form thereof , where the substituents Ria, Rir, Ric, Ria (each representative of the scope of Ri) and Raa, when present, are indicated in the table below; and “-” indicates that one or more substituents Ria, Rip, Ric, Ria E Rea are not present: Ric Ric 4 AR Ria O) *% E) Riy N — N (I1b5)
[00194] [00194] In another aspect the invention provides compounds of Formula (Ib), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib6) or a form thereof , in which the substituents Ria, Riww, Ric E Ria (each representative of the scope of Ri), when present, are indicated in the table below; and “-” "indicates that one or more substituents Ria, Rir, Ric And Ria are not present: Re Ria NH Ria SN
[00195] [00195] In another aspect the invention provides compounds of Formula (TIb), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib7) or a form thereof , where the Riww substituent, when present, is indicated in the table below: Riw (Y and N / N — N
[00196] [00196] In another aspect the invention provides compounds of Formula (Ib), or a form thereof, for use in the methods described herein, wherein the compound is selected from a compound of Formula (Ib8) or a form thereof , where the Riww substituent, when present, is indicated in the table below: N Riw Ds / Ss MA yo SIIx / N — N
[00197] [00197] The compounds provided herein can be prepared by those skilled in the art, such as by the synthetic methods presented in International Patent Application Number PCT / US2013 / 054687, filed on August 13, 2013 and published as International Publication Number WO2014 / 028459 on February 20, 2014; International Patent Application Number
[00198] [00198] In one aspect, the compound of Formula (TI), used in a method described here, is a compound selected from the group consisting of: H | N PD N O -.N NH SN, -N NH
[00199] [00199] In another aspect, the compound of Formula (II), used in a method described here, is a compound selected from the group consisting of: | H TO AND O
[00200] [00200] In another aspect, the compound of Formula (II), or a form thereof, used in a method described herein is a compound of Formula (1) or a form thereof (in which the compound number (no.) indicates that the salt form was isolated) selected from the group consisting of: Compound Name 1 6- (naphthalen-2-yl) -N- (2,2,6,6-tetramethylpiperidin-4-yl) pyridazin- 3-amine 2 6- (benzo [b] thiophen-2-yl) -N-methyl-N- (2,2,6,6-tetramethylpiperidin-4-yl) pyridazin-3-amine 3 2- (6- (2,2,6,6-tetramethylpiperidin-4-yl-amino) - pyridazin-3-yl) phenol 2- (6- (methyl- (2,2,6,6-tetramethylpiperidin-4- 4 yl) amino ) pyridazin-3-yl) benzo [b] -thiophene-5-carbonitrile 6- (quinolin-3-yl) -N- (2,2,6,6-tetramethylpiperidin-4-yl) pyridazin-3-amine 6 3- (benzo [b] -tiofen-2-11) -6- (2,2,6,6- tetramethylpiperidin-4-yl-oxy) pyridazine 7 2- (6- (methyl- (2,2,6 , 6-tetramethylpiperidin-4-yl) amino) -pyridazin-3-1yl) phenol 8 6- (6- (methyl- (2,2,6,6-tetramethylpiperidin-4-yl) amino) -pyridazin-3- il) naphthalen-2-ol 9 6- (benzo [b] -thiophen-2-yl) -N- (2,2,6 , 6- tetramethylpiperidin-4-yl) pyridazin-3-amine 7T- (6 - ((2,2,6,6-tetramethylpiperidin-4-yl) oxy) pyridazin-3-yl) isoquinoline 11 6- (6- ((2,2,6,6-tetramethylpiperidin-4-yl) oxy) pyridazin-3-yl) isoquinoline 12 N-methyl-6- (quinolin-7-yl) -N- (2,2,6,6 - tetramethylpiperidin-4-yl) pyridazin-3-amine 13 N-methyl-6- (quinolin-6-yl) -N- (2,2,6,6- tetramethylpiperidin-4-yl) pyridazin-3-amine 14 6- (isoquinolin-7-yl) -N-methyl-N- (2,2,6,6-tetramethylpiperidin-4-yl) pyridazin-3-amine 6- (isoquinolin-6-yl) -N-methyl- N- (2,2,6,6- tetramethylpiperidin-4-yl) pyridazin-3-amine
[00201] [00201] In another aspect, the compound of Formula (II), or a form thereof, used in a method described herein is a compound selected from the group consisting of: Compound Name 2- (6 - [(1R, 5S) -8-azabicyclo [3.2.1] oct-3- 411º yl (methyl) amino] pyridazin-3-yl) -5- (1H-pyrazol-4-yl) phenol 4121 2- [6- ((1R , 5S5) -8-azabicyclo [3.2.1] oct-3-ylamino) pyridazin-3-yl] -5- (11H-pyrazol-4-yl) phenol 4131 5- (1H-pyrazol-4-11) - 2- (6 - [(2,2,6,6-tetramethylpiperidin-4-yl) amino] pyridazin-3-yl) phenol 414 5- (1I-methyl-1H-pyrazol-4-yl) -2- ( 6 - [(2,2,6,6- tetramethylpiperidin-4-yl) oxy] pyridazin-3-yl) phenol 415 2- [6- ((1R, 5S) -8-azabicyclo [3.2.1] oct- 3-yloxy) pyridazin-3-yl] -5- (1H-pyrazol-4-yl) phenol 416 5- (S5-methyl-1H-pyrazol-4-yl) -2- (6- [methyl (2, 2,6,6- tetramethylpiperidin-4-yl) amino] pyridazin-3-yl) phenol 417 5- (11H-imidazol-1-yl) -2- (6 - [(2,2,6,67 tetramethylpiperidin- 4-yl) oxy] pyridazin-3-yl) phenol 418 5- (S5-methyl-1H-pyrazol-4-yl) -2- (6 - [(2,2,6,6-tetramethylpiperidin-4-yl ) oxy] pyridazin-3-yl) phenol 2- (6- [methyl (2,2,6,6-tet ramethylpiperidin-4- 419º yl) amino] pyridazin-3-yl) -5- (4-nitro-1H-pyrazol-1-yl) phenol 6- [2-methoxy-4- (4-nitro-1H-pyrazol- 1-yl) phenyl] -N- 420 methyl-N- (2,2,6,6-tetramethylpiperidin-4-yl) pyridazin-3-amine 421 5- (4-amino-1H-pyrazol-1-yl) -2- (6 - [(2,2,6,6- tetramethylpiperidin-4-yl) oxy] lpiridazin-3-yl) phenol 4221 2- [6- (1-methyl-1,2,3,6- tetrahydropyridin-4-yl) pyridazin-3-yl] -5- (1H-pyrazol-4-yl) phenol 1423 5- (4-nitro-1H-pyrazol-1-yl) -2- (6 - [(2 , 2,6,6- tetramethylpiperidin-4-yl) oxy] lpiridazin-3-yl) phenol 4241 5- (11H-pyrazol-4-yl) -2- [6- (1,2,3,6- tetrahydropyridin -4-yl) pyridazin-3-yl] phenol 4251 2- [6- (1-ethyl-1,2,3,6-tetrahydropyridin-4-yl) pyridazin-3-yl] -5- (1H-pyrazole -4-yl) phenol 426! 2- (6- [methyl (piperidin-4-yl) amino] pyridazin-3-i11) -5- (1H-pyrazol-4-yl) phenol 1271 2- [6- (piperidin-4-ylamino) pyridazin- 3-yl] -5- (1H-pyrazol-4-yl) phenol
[00202] [00202] In another aspect, the compound of Formula (I), or a form thereof, used in a method described herein is a salt of the compound selected from the group consisting of: Compound Name 2- (6-) Hydrochloride (methyl (2,2,6,6- 53 tetramethylpiperidin-4-yl) amino) pyridazin-3-yl) -4- (1H-pyrazol-1-1yl) phenol 65 2- (6-piperazin-l hydrochloride -yl-pyridazin-3-yl) - S-1H-pyrazol-l1-yl-phenol 82 3- (6- (piperazin-l-yl) pyridazin-3-yl) naphthalene-2,7-diol trifluoroacetate 3- (6- (1,2,3,6- 86 tetrahydropyridin-4-yl) pyridazin-3-yl) naphthalene-2,7T-diol 3- (6- (1-methyl-1,2 trifluoroacetate , 3,6- 88 tetrahydropyridin-4-yl) pyridazin-3-yl) naphthalene-2,7-diol 89 3- (6- (piperidin-4-yl) pyridazin-3-yl) naphthalene-2 trifluoroacetate, 7-diol 6-hydroxy-5- (6- (methyl (2,2,6,6- 151 tetramethylpiperidin-4-yl) amino) pyridazin-3-yl) - 2,3-dihydro-1H-inden -l-one oxime 2-Amino-6- (6- (methyl (2,2,6,6- 153 tetramethylpiperidin-4-yl) amino) pyridazin-3-yl) -8H- indene [1,2 -d] thiazole-5-ol 9- (6- (methyl (2,2,6,6-tetramethylpiperidin-4- 154 yl) amino) pyridazin-3-1yl) -5,6-dihydroimidazo [5.1- a] isoquinolin-8-ol Hydrochloride of 3-fluoro-5- (2-methoxypyridin-4-yl) -2- 160 (6- (methyl (2,2,6,6-tetramethylpiperidin-4-yl) amino) pyridazin-3-yl) phenol Hydrochloride 4- (3-fluoro-5-hydroxy-4- (6- 161 (methyl (2,2,6,6-tetramethylpiperidin-4-yl) amino) pyridazin-3-yl) phenyl) pyridin-2 (1H ) -one
[00203] [00203] In another aspect, the compound of Formula (I), used in a method described herein, is a salt of the compound selected from the group consisting of: Compound Name 2- (6- [8-azabicyclo [ 3.2.1] oct-3- 411 yl (methyl) amino] pyridazin-3-yl) -5- (1H-pyrazol-4-yl) phenol 412 2- [6- (8-azabicyclo [3.2.1 ] oct-3-ylamino) pyridazin-3-yl] -5- (11H-pyrazol-4-yl) phenol 413 5- (11H-pyrazol-4-yl) -2- (6 - [(2, 2,6,6- tetramethylpiperidin-4-yl) amino] pyridazin-3-yl) phenol 415 2- [6- (8-azabicyclo [3.2.1] oct-3-yloxy) pyridazin-3-yl] hydrochloride] -5- (1H-pyrazol-4-yl) phenol 2- (6- [methyl (2,2,6,6- 419 tetramethylpiperidin-4-yl) amino] pyridazin-3-yl) -5- ( 4- nitro-1H-pyrazol-1-1yl1) phenol 2- [6- (1-methyl-1,2,3,6- 422 tetrahydropyridin-4-yl) pyridazin-3-yl] -5- ( 1H-pyrazol-4-yl) phenol 424 5- (11H-pyrazol-4-yl) -2- [6- (1,2,3,6-tetrahydropyridin-4-1yl) pyridazin-3-yl hydrochloride] phenol 2- [6- (1-ethyl-1,2,3,6- 425 tetrahydropyridin-4-yl) pyridazin-3-i hydrochloride l1] -5- (1H-pyrazol-4-yl) phenol
[00204] [00204] In this specification, the term "Cisalkyl" generally refers to saturated hydrocarbon radicals having one to four carbon atoms in a straight or branched chain configuration, including, but not limited to, methyl, ethyl, n-propyl isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl and the like. In some ways, Ciasalquila includes Ci3zalquila, Ci-2alkyl and the like. A Ciasalquila radical can be optionally substituted when allowed by the available valences.
[00205] [00205] In this specification, the term “Coçsalquenila” generally refers to partially unsaturated hydrocarbon radicals having two to five carbon atoms in a straight or branched chain configuration and one or more carbon-carbon double bonds, including, among others, ethylene, allyl, propenyl and the like. In some respects, Cr-salkenyl includes Cr-alkenyl, Cr-3zalkenyl and the like.
[00206] [00206] In this specification, the term “Cisalcoxy” refers in general to saturated hydrocarbon radicals having one to four carbon atoms in a straight or branched chain configuration of the formula: -O-Cisalkyl, including, among others, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy and the like. In some respects, Ci-salcoxy includes Ci-zalcoxy, Ciczalcoxi and the like. A Cialcoxy radical can be optionally substituted when allowed by the available valences.
[00207] [00207] In this specification, the term "C3a-ucycloalkyl" generally refers to a saturated monocyclic, bicyclic or polycyclic hydrocarbon radical, including, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, lH-indanyl, indenyl, tetrahydro-naphthalenyl and the like. In some aspects, C3-1a4cCycloalkyl includes C3-10cycloalkyl, C3-scicloalkyl, C3-cycloalkyl, Cs-gcycloalkyl, Co-10cycloalkyl and the like. A C3-1ucicloalkyl radical can be optionally substituted when allowed by the available valences.
[00208] [00208] In this specification, the term "C3-14cycloalkenyl" generally refers to a partially unsaturated monocyclic, bicyclic or polycyclic hydrocarbon radical having one or more chemically stable carbon-carbon double bonds, including, among others, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl and the like. In some ways, C3a-14cycloalkenyl includes C3-icycloalkenyl, C3-scicloalkenyl, Cs-scicloalkenyl,
[00209] [00209] In this specification, the term "aryl" generally refers to a radical with a monocyclic, bicyclic or polycyclic ring structure with carbon atoms, including, among others, phenyl, naphthyl, anthracenyl, fluorenyl, azulenyl, phenanthrenyl and the like. An aryl radical can be optionally substituted when allowed by the available valences.
[00210] [00210] In this specification, the term "heteroaryl" generally refers to a radical with a monocyclic, bicyclic or polycyclic aromatic ring structure with carbon atoms, in which one or more members of the carbon atom ring have been replaced, when permitted by structural stability, by one or more heteroatoms, such as an O, S or N atom, including, but not limited to, furanyl, thienyl (also referred to as thiophenyl), pyrrolyl, pyrazolyl, imidazolyl, isoxazolyl, isothiazolyl, oxazolyl, thiazolyl , triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyranyl, thiopyranil, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, indolyl, indazolyl, indolizinyl, benzofuranyl, benzothienyl, benzimidazole, benzimidazol, benzimidazol, benzimidazol , quinazolinyl, acridinyl, phthalazinyl, imidazo [1,2-alpyridinyl, imidazo [1,5-a] pyridinyl, imidazo [5,1- a] lysoquinolinyl, 1,4-dihydroindene [1,2-c] -l H-pyrazolyl, 2,3-dihydro-1H-inden-1-one, 2,3-dihydro-1H-indenyl, 3,4-dihydroquinolin-2 (1H) -one, 5,6-dihydroimidazo [5.1 -
[00211] [00211] In this specification, the term "heterocyclyl" generally refers to a radical with a monocyclic, bicyclic or polycyclic ring structure with saturated or partially unsaturated carbon atoms, in which one or more carbon atoms are members of the ring have been replaced, when permitted by structural stability, with a heteroatom, such as an O, S or N atom, including, but not limited to, oxiranyl, oxetanil, azetidinyl, dihydrofuranyl, tetrahydrofuranyl, dihydrothienyl, tetrahydrothienyl, pyrrolinyl, pyrrolidinyl, di pyrrolidinyl, di pirazolinila, pirazolidinila, dihidroimidazolila, imidazolinila, imidazolidinila, isoxazolinila, isoxazolidinila, isotiazolinila, isotiazolidinila, oxazolinila, oxazolidinila, tiazolinila, tiazolidinila, triazolinila, triazolidinila, oxadiazolinila, oxadiazolidinila, tiadiazolinila, tiadiazolidinila, tetrazolinila, tetrazolidinila, dihydro-2H-pyranyl, dihydro- pyridinyl, tetrahydro-pyridinyl, 1,2,3,6- tetrahydropyridinyl, hex a-tetrahydro-pyridinyl, dihydro-pyrimidinyl, tetrahidropirimidinila, 1,4,5,6-7 tetrahidropirimidinila, dihydro-pyrazinyl, pyrazinyl tetrahydro, dihydro-pyridazinyl, tetrahydro-pyridazinyl, piperazinyl, piperidinyl, morpholinyl, tiomorfolinila,
[00212] [00212] In this specification, the term "Crsalkenyl-amino-carbonyl" refers to a radical of the formula: -C (= O) -NH- Cr-aalkenyl.
[00213] [00213] In this specification, the term "Cisalcoxy-Cisalcoxy" refers to a radical of the formula: -O-r Ci-salquil-O-Ci-salquila.
[00214] [00214] In this specification, the term "Ci4salcoxycarbonyl" refers to i, radical of the formula: -C (= 0) -O-C1i- aalkyl.
[00215] [00215] In this specification, the term "Cisalcoxy-carbonyl-amino" refers to a radical of the formula: -NH-C (= 0) -O-Ci 1 alkyl.
[00216] [00216] In this specification, the term "Cisalcoxy-carbonyl-amino-C1-alkoxy" refers to a radical of the formula: -O-C1-alkyl-NH-C (= 0) -O-Ci-salkyl.
[00217] [00217] In this specification, the term "Cisalkyl-Cr 1alkoxy" refers to a radical of the formula: -O-Ci-cyalkyl-C1-1alkyl.
[00218] [00218] In this specification, the term "Cisalkyl-amino" refers to a radical of the formula: -NH-Ci-'salquila.
[00219] [00219] In this specification, the term "(Ci-akyl)> - amino" refers to a radical of the formula: -N (Cisalkyl) 2.
[00220] [00220] In this specification, the term "Cisalkyl-amino-C1- 1aalkoxy" refers to a radical of the formula: -O-Ci-salkyl-NH-C1- 1salkyl.
[00221] [00221] In this specification, the term “(Ci-salkyl)> - amino- Ci-aalkoxy” refers to a radical of the formula: -O-Cisalkyl- N (Ci-salkyl), .
[00222] [00222] In this specification, the term "Ci-salkyl-amino-C1-1alkyl" refers to a radical of the formula: -Ci-salkyl-NH-C1-1alkyl.
[00223] [00223] In this specification, the term "(Ci-salkyl); - amino-Ci-salkyl" refers to a radical of the formula: -Cisalkyl- NíCi-aalkyl)> .
[00224] [00224] In this specification, the term "Cisalkyl-amino-carbonyl" refers to a radical of the formula: -C (= O) -NH-C1- aalkyl.
[00225] [00225] In this specification, the term “(Ci-salkyl) 2: -amino-carbonyl” refers to a radical of the formula: -C (= O) -N (C1i- 1salkyl)> 2.
[00226] [00226] In this specification, the term "Cisalkyl-amino-carbonyl-Cisalkyl" refers to a radical of the formula: -C1-1-alkyl-C (= 0) -NH-Ci-salkyl.
[00227] [00227] In this specification, the term "(Ci-salkyl); - amino-carbonyl-Ci1alkyl" refers to a radical of the formula: -C1i 1alkyl-C (= O0) -N (Ci-aalkyl)> .
[00228] [00228] In this specification, the term "Ci-salkyl-carbonyl" refers to a radical of the formula: -C (= O) -Ci4salkyl.
[00229] [00229] In this specification, the term "Ci-aalkyl-carbonyl-amino" refers to a radical of the formula: -NH-C (= O) -Ci-salkyl.
[00230] [00230] In this specification, the term "Cisalkyl-carbonyl-amino-Ci-aalkoxy" refers to a radical of the formula: -O-Cr 1salkyl-NH-C (= 0) -Ci-salkyl.
[00231] [00231] In this specification, the term "Ci-salkyl-carbonyl-amino-Ci-aalkyl" refers to a radical of the formula: -Cisalkyl-NH-C (= 0) -Ci-akyl.
[00232] [00232] In this specification, the term "amino" refers to a radical of the formula: -NH>.
[00233] [00233] In this specification, the term "amino-Ci-salcoxy" refers to a radical of the formula: -O-Ci-alkyl-NH>.
[00234] [00234] In this specification, the term "amino-Ci-salkyl" refers to a radical of the formula: -Cisalkyl-NH ,.
[00235] [00235] In this specification, the term "amino-carbonyl" refers to a radical of the formula: -C (= O) -NH :.
[00236] [00236] In this specification, the term “cyan” refers to a radical of the formula: -CN.
[00237] [00237] In this specification, the term “C3z-; cycloalkyl-C1- aalkoxy” refers to a radical of the formula: -O-Cisalkyl- C3-cycloalkyl.
[00238] [00238] In this specification, the term “halo-Cisalcoxy” refers to a radical of the formula: -O-Ci-salkyl-halo, where C1-1alkyl can be partially or completely substituted when allowed by the valences available with a or more halogen atoms. In some aspects, halo-Cisalcoxy includes halo-C1-salcoxy, halo-C1-salcoxy and the like.
[00239] [00239] In this specification, the term “halo-Ci-salquila” refers to a radical of the formula: -Cisalkyl-halo, where C1-1alkyl can be partially or completely replaced when allowed by the valences available with one or more halogen atoms. In some respects, halo-Ciasalkyl includes halo-Ci-salquila, halo-Cisalquila and the like.
[00240] [00240] In this specification, the term "heteroaryl-C1-1salkyl" refers to a radical of the formula: -Cisalkyl-heteroaryl.
[00241] [00241] In this specification, the term "heteroaryl-C1-1alkyl-amino" refers to a radical of the formula: -NH-Cisalkyl-heteroaryl.
[00242] [00242] In this specification, the term "heteroaryl-C; - 1 alkyl-amino-carbonyl" refers to a radical of the formula: - C (= O0) -NH-Ci-salkyl-heteroaryl.
[00243] [00243] In this specification, the term "heteroaryl-C; - 1-alkyl-amino-carbonyl-Ci-aalkyl" refers to a radical of the formula: -Ci-salkyl-C (= O0) -NH-Ci-salkyl -heteroaryl.
[00244] [00244] In this specification, the term "heteroaryl-C1ialkylcarbonyl-amino" refers to a radical of the formula: -NH- C (= 0) -Ci-aalkylheteroaryl.
[00245] [00245] In this specification, the term "heteroaryl-C1-salkyl-carbonyl-amino-C1-asalkyl" refers to a radical of the formula: -Ci-aalkyl-NH-C (= 0O) -Ci-aalkyl- heteroaryl.
[00246] [00246] In this specification, the term "heterocyclyl-C1; - 1 alkoxy" refers to a radical of the formula: - Ci-salcoxy-heterocyclyl.
[00247] [00247] In this specification, the term "heterocyclyl-C1-aalkyl" refers to a radical of the formula: -Cisalkyl-heterocyclyl.
[00248] [00248] In this specification, the term "hydroxyl" refers to a radical of the formula: -OH.
[00249] [00249] In this specification, the term “hydroxyl-Cisalcoxy” refers to a radical of the formula: -O-Ci-salkyl-OH, where C1-1alkyl can be partially or completely replaced when allowed by the valences available with a or more hydroxy radicals.
[00250] [00250] In this specification, the term “hydroxyl-C1-1alkyl” refers to a radical of the formula: -Cisalkyl-OH, where Cisalkyl can be partially or completely replaced when allowed by the valences available with one or more hydroxy radicals .
[00251] [00251] In this specification, the term "hydroxyl-Cisalkyl-amino" refers to a radical of the formula: -NH-Ci-xalkyl-OH, where Cisalkyl can be partially or completely replaced when allowed by the valences available with a or more hydroxyl radicals.
[00252] [00252] In this specification, the term “hydroxylimino” refers to the radical = NOH of the formula: C (= NOH).
[00253] [00253] In this specification, the term “oxo” refers to the radical of the formula: C = 0O.
[00254] [00254] In this specification, the term "phenyl-Ci-salcoxy" refers to a radical of the formula: -Cisalcoxy-phenyl.
[00255] [00255] In this specification, the term "substituent" means positioning variables on the atoms of a central molecule, which are replaced at a position of the designated atom, replacing one more hydrogens on the designated atom, provided the atom's normal valence designated area is not exceeded, and that the replacement results in a stable compound. Combinations of substituents and / or variables are permitted only if such combinations result in stable compounds. Any person skilled in the art would observe that any carbon as well as a heteroatom with valences that appear not satisfied as described or shown at present, is supposed to have a sufficient number of hydrogen atoms to satisfy the valences described or shown. In certain cases, one or more substituents having a double bond (eg, "oxo" or "= 0") as the point of attachment can be described, shown or listed herein within a substituent group,
[00256] [00256] In this specification, the term “and the like”, with reference to the definitions provided of technical terms, means that variations in chemical structures that could be expected by the technician in the subject include, among others, isomers (including structural isomers of chain, branch and position), hydration of ring systems (including saturation or partial unsaturation of monocyclic, bicyclic or polycyclic ring structures) and all other variations when permitted by the available valences that result in a stable compound.
[00257] [00257] For the purposes of this description, when one or more variables of substituents for a compound of Formula (I) or a form thereof encompass functionality incorporated into a compound of Formula (1), each functionality appearing at any location within the disclosed compound can be independently selected, and if appropriate, independently replaced and / or optionally replaced.
[00258] [00258] In this specification, the terms "independently selected" or "each selected" refer to the functional variables in a list of substituents that may occur more than once in the formula (1) structure and that the substitution pattern in each occurrence is independent of the pattern in any other occurrence. In addition, it is understood that the use of a variable of a generic substituent in any formula or structure for a compound described herein includes replacing the generic substituent with substituents of the species that are included within the particular genus, e.g. e.g., aryl can be replaced by phenyl or naphthalenyl, and the like, and that the resulting compound should be included within the scope of the compounds described herein.
[00259] [00259] In this specification, the terms “each case of” or “in each case, when present”, when used before an expression such as “..C3az-1ucicloalkyl, C3-iacicloalkyl-Cisalkyl, aryl, aryl-Ci- salkyl, heteroaryl, heteroaryl-C1-salkyl, heterocyclyl and heterocyclyl-Cisalkyl ”, aims to refer to C3a-140 ring systems, cycloalkyl, aryl, heteroaryl and heterocyclyl when each is present or as a substitute.
[00260] [00260] In this specification, the term "optionally substituted" means an optional substitution with the variables specified for substituents, groups, radicals or portions.
[00261] [00261] In this specification, the term "form" means a compound of Formula (1) whose form is selected from the group consisting of free acid, free base, prodrug, salt, hydrate, solvate, clathrate, isotopologist , racemate, enantiomer, diastereoisomer, stereoisomer, polymorph and tautomer thereof.
[00262] [00262] In certain aspects described herein, the form of the compound of Formula (1) is a free acid, free base or salt thereof.
[00263] [00263] In certain aspects described herein, the form of the compound of Formula (1) is a salt thereof.
[00264] [00264] In certain aspects described herein, the form of the compound of Formula (1) is an isotopologist of the same.
[00265] [00265] In certain aspects described herein, the form of the compound of Formula (1) is a stereoisomer, racemate, enantiomer or diastereoisomer thereof.
[00266] [00266] In certain aspects described herein, the form of the compound of Formula (1) is a tautomer thereof.
[00267] [00267] In certain aspects described herein, the form of the compound of Formula (1) is a pharmaceutically acceptable form.
[00268] [00268] In certain aspects described herein, the compound of Formula (1) or a form thereof is isolated for use.
[00269] [00269] In this specification, the term “isolated” means the physical state of a compound of Formula (TI) or a form of it after being isolated and / or purified from a synthetic process (eg, from a reaction mixture) or natural source or combination thereof according to an isolation or purification process or processes described herein or which are well known to the person skilled in the art (eg, chromatography, recrystallization and the like) in sufficient purity to be characterized by standard analytical techniques described herein or well known to the person skilled in the art.
[00270] [00270] In this specification, the term "protected" means that a functional group in a compound of Formula (1), or a form thereof, is in a modified form to prevent unwanted side reactions at the protected site when the compound is subjected to a reaction. Suitable protective groups will be recognized by any person skilled in the art as well as by reference to standard textbooks such as T.W. Greene et al, Protective Groups in organic Synthesis (1991),
[00271] [00271] In this specification, the term "prodrug" means a form of a compound of the invention (eg, a pharmacological precursor) that is transformed in vivo to produce an active compound of Formula (I) or a form the same. Transformation can occur by several mechanisms (eg, by metabolic and / or non-metabolic chemical processes), such as, for example, by hydrolysis and / or metabolism in the blood, liver and / or other organs and tissues. A discussion of the use of prodrugs is provided by T. Higuchi and W. Stella, “Pro-drugs as Novel Delivery Systems”, Vol. 14 of A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
[00272] [00272] In one example, when a compound of Formula (LI) or a form thereof contains a functional group carboxylic acid, a prodrug can include an ester formed by replacing the acid hydrogen atom with a functional group such as alkyl and the like. In another example, when a compound of Formula (I) or a form thereof contains a hydroxyl group of functional group, a form of prodrug can be prepared by replacing the hydrogen atom of hydroxyl with another functional group such as alkyl, alkylcarbonyl or a phosphonate ester and the like. In another example, when a compound of Formula (1) or a form thereof contains a functional group amine, a form of prodrug can be prepared by replacing one or more hydrogen atoms of the amine with a functional group such as alkyl or substituted carbonyl. the pharmaceutically acceptable prodrugs of compounds of Formula (LI), or a form thereof, include those compounds substituted with one or more of the following groups: esters of carboxylic acids, sulfonate esters, amino acid esters, phosphonate esters and esters of mono, di or triphosphate esters or alkyl substituents, where appropriate, As described herein, any person skilled in the art understands that one or more of such substituents can be used to provide a compound of Formula (1) or a form thereof as a prodrug.
[00273] [00273] One or more compounds described herein may exist in unsolvated forms, as well as solvated with pharmaceutically acceptable solvents such as water, ethanol and the like, and this description is intended to cover both solvated and unsolvated forms.
[00274] [00274] In this specification, the term "solvate" means a physical association of a compound described here with one or more molecules of the solvent. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain cases, the solvate will be capable of isolation, for example, when one or more molecules of the solvent are incorporated into the crystalline network of the crystalline solid. In this specification, “solvate” covers solvates in the solution phase and solvates that can be isolated. Non-limiting examples of suitable solvates include ethanolates, methanolates and the like.
[00275] [00275] In this specification, the term "hydrate" means a solvate in which the solvent molecule is water.
[00276] [00276] The compounds of Formula (I) can form salts, which are intended to be included within the scope of that description. It is understood that a reference to a compound of Formula (1) or a form thereof includes a reference to salt forms thereof, unless otherwise indicated. The term "salt (s)", as used, indicates acid salts formed with inorganic and / or organic acids, as well as basic salts formed with inorganic and / or organic bases. In addition, when a compound of Formula (1) or a form thereof contains a basic portion such as, but not limited to, an amine portion, and an acidic portion, such as, but not limited to, a carboxylic acid, zwitterions ("internal salts") can be formed and are included within the term “salt (s)” in this specification.
[00277] [00277] The term "pharmaceutically acceptable salt (s)" in this specification means those salts of compounds described herein that are safe and effective (that is, non-toxic, physiologically acceptable) for use in mammals and that have biological activity, although other salts are useful as well. The salts of the compounds of Formula (I) can be formed, for example, by reacting a compound of Formula (I) or a form thereof with an amount of acid or base, as an equivalent amount, in a medium, such as that in which the salt precipitates, or in an aqueous medium followed by lyophilization.
[00278] [00278] Pharmaceutically acceptable salts include one or more salts of acidic or basic groups present in compounds described herein. In certain respects, acid addition salts may include, but are not limited to, acetate, ascorbate, benzoate, benzenesulfonate, bisulfate, bitartrate, borate, bromide, butyrate, chloride, citrate, camphorate, camphosulfonate, ethanesulfonate, format, fumarate, gentisinate , gluconate, glucaronate, glutamate, iodide, isonicotinate, lactate, maleate, methanesulfonate, naphthalenesulfonate, nitrate, oxalate, pamoate, pantothenate, phosphate, propionate, saccharate, salicylate, succinate, sulphate, tartarate, also known as thiocyanate, tolate , trifluoroacetate and the like. Certain aspects of the acid addition salts may further include chloride, dichloride, trichloride, bromide, acetate, formate or trifluoroacetate salts.
[00279] [00279] Additionally, acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use. (2002) Zurich: Wiley-VCH; Ss. Berge et al, Journal of Pharmaceutical Sciences (1977) 66 (1) 1-19; P. Gould, International J. of Pharmaceutics (1986) 33, 201-217; eerson et al, The Practice of Medicinal Chemistry (1996), Academic Press, New York; and The Orange Book (Food & Drug Administration, Washington, D.C. on its website). These discussions are incorporated into this patent application by reference to them.
[00280] [00280] Suitable basic salts include, but are not limited to, aluminum, ammonium, calcium, lithium, magnesium, potassium, sodium and zinc salts.
[00281] [00281] All such acid salts and base salts are intended to be encompassed by pharmaceutically acceptable salts as described herein. In addition, all such acid salts and base salts are considered equivalent to the free forms of the corresponding compounds for the purposes of this description.
[00282] [00282] The compounds of Formula (I) and their forms can still exist in a tautomeric form. All such tautomeric forms are contemplated and included within the scope of the compounds of Formula (1) or a form thereof described herein.
[00283] [00283] The compounds of Formula (I) or a form thereof may contain asymmetric or chiral centers and therefore exist in different stereoisomeric forms. The present description is intended to include all stereoisomeric forms of the compounds of Formula (1) as well as their mixtures, including racemic mixtures.
[00284] The compounds described herein can include one or more chiral centers and, as such, can exist as racemic mixtures (R / S) or as substantially pure enantiomers and diastereoisomers. The compounds can also exist as substantially pure (R) or (S) enantiomers (when a chiral center is present). In one aspect, the compounds described herein are isomers (Ss) and can exist as enantiomerically pure compositions comprising substantially only the (S) isomer. In another aspect, the compounds described herein are (R) isomers and can exist as enantiomerically pure compositions comprising substantially only the (R) isomer. As will be recognized by the person skilled in the art, when more than one chiral center is present, the compounds described herein may also exist as an isomer (R, R), (R, S), (S, R) or (S, S) , as defined by the IUPAC Nomenclature Recommendations.
[00285] [00285] In this specification, the term "substantially pure" refers to compounds that consist substantially of a single isomer in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99% or in an amount equal to 100% of the single isomer.
[00286] [00286] In one aspect of the description, a compound of Formula (1) or a form thereof is in the form of substantially pure enantiomer (S) present in an amount greater than or equal to 90%, in an amount greater than or equal to 92 %, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99% or in an amount equal to 100%.
[00287] [00287] In another aspect the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described herein.
[00288] [00288] In one aspect of the description, a compound of Formula (LI) or a form thereof is in the form of a substantially pure enantiomer (R) enantiomer present in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99% or in an amount equal to 100%.
[00289] [00289] In another aspect the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described herein.
[00290] [00290] In this specification, a “racemate” is any mixture of isomeric forms that are not “enantiomerically pure”, including mixtures such as, among others, in a ratio close to 50/50, close to 60/40, close to 70 / 30 or close to 80/20.
[00291] [00291] In another aspect the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described herein.
[00292] [00292] In addition, this description covers all geometric and positional isomers. For example, if a compound of Formula (1) or a form thereof incorporates a double bond or a fused ring, both cis and trans forms, as well as mixtures, fall within the scope of the description. Diastereoisomeric mixtures can be separated into their individual diastereoisomers based on their physical-chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and / or fractional crystallization. Enantiomers can be separated by using a chiral HPLC column or by other chromatographic methods known to those skilled in the art. Enantiomers can also be separated by converting the enantiomeric mixture into a diastereoisomeric mixture by reaction with a suitable optically active active compound (eg, chiral auxiliary such as a chiral alcohol or Mosher acid chloride), separating the diastereomers and converting (e.g. hydrolyzing) the individual diastereoisomers to the corresponding pure enantiomers. In addition, some of the compounds of Formula (TI) may be atropisomers (eg, substituted biaryls) and are considered part of this description.
[00293] [00293] In another aspect, the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described herein.
[00294] [00294] All stereoisomers (for example, "geometric isomers, optical isomers and the like) of the present compounds (including those of the salts, solvates, esters and prodrugs of the compounds, as well as the salts, solvates and esters of the prod- drugs), such as those that may exist due to asymmetric carbons in various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), “rotameric forms, atropisomers and diastereoisomeric forms, are contemplated and covered by this description, as well as o are positional isomers (such as, for example, 4-pyridyl and 3-pyridyl). the individual stereoisomers of the compounds described herein may, for example, be substantially free of other isomers or may be present in a racemic mixture, as described above.
[00295] [00295] In another aspect, the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described herein.
[00296] [00296] The use of the terms "salt", "solvate", "ester", "prodrug" and the like is also intended to apply to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers , tautomers, positional isomers, racemates or isotopologists of the present compounds.
[00297] [00297] In another aspect, the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Tb) for use in the methods described herein.
[00298] [00298] The term "isotopologist" refers to compounds described herein isotopically enriched that are identical to those recited above, except that one or more atoms are replaced by an atom with an atomic mass or mass number other than the atomic mass or number of mass normally found in nature. Examples of isotopes that can be incorporated into compounds described herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as H, 3H, 13C, 14C, SN, 180, 1V7O, 31p, 32p, 358, 186F, Cl and 36Cl, respectively, each of which also falls within the scope of this description.
[00299] [00299] In another aspect the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Ib) for use in the methods described herein.
[00300] [00300] Certain isotopically enriched compounds described herein (e.g., those marked with * H and * "C) are useful in assays for compound and / or substrate distribution in tissues. Isotopes with tritium (ie, H) and carbon-l14 (ie! * "C) are especially preferred because they are easy to prepare and detect. In addition, substitution with heavier isotopes such as deuterium (ie º H) can provide certain therapeutic advantages resulting from increased metabolic stability (eg, increased in vivo half-life or lower dose requirements) and, therefore, they may be preferred in some circumstances.
[00301] [00301] In another aspect, the invention provides compounds of Formula (1) selected from a compound of Formula (Ia) and Formula (Tb) for use in the methods described herein: crystalline and amorphous polymorphic forms of the compounds of Formula (1 ) and the salts, solvates, hydrates, esters and prodrugs of the compounds of Formula (1) are further intended to be included in the present description.
[00302] [00302] The names of the compounds provided were obtained using the ACD Labs Index Name software, supplied by ACD Labs, and / or the ChemDraw Ultra software provided by CambridgeSoftº. When the name of the described compound conflicts with the depicted structure, the structure shown will supersede the use of the name to define the intended compound. The nomenclature for substituent radicals defined herein may differ slightly from the chemical name from which they are derived .; the person skilled in the art will recognize that the definition of the substituent radical is intended to include the radical as found in the chemical name.
[00303] [00303] In this specification, the term "aberrant" refers to a deviation from normality, p. the average healthy individual or a sample of cell (s) or tissue from a healthy individual. The term “aberrant expression” in this specification refers to the abnormal expression (up-regulated or down-regulated in an excessive or deficient amount) of a gene product (eg, transcribed from RNA or protein) by a sample of cells, tissue or individual in relation to a corresponding normal cell, tissue or individual sample. In a specific aspect, “abnormal expression” refers to an altered level of a gene product (eg, RNA or protein transcript) in a sample of cells, tissue or individual in relation to a sample of cells, corresponding normal tissue or individual. The term "abnormal amount" in this specification refers to an altered level of a gene product (eg, RNA, protein, polypeptide or peptide) in a cell, tissue sample or individual in relation to a cell , tissue sample or corresponding normal individual. In specific respects, the amount of a gene product (eg, RNA, protein, polypeptide or peptide) in a sample of cells, tissue or individual in relation to a corresponding cell or tissue sample from a healthy individual or in a healthy individual, is considered abnormal, if it is 1; 1.5; 2; 2.5; 3; 3.5; 4; 4.5; 5; 5.5; 6 times or more above or below the amount of the gene product in the cell or tissue sample of a healthy individual or healthy individual.
[00304] [00304] The term "intronic REMS" refers to a sequence of REMS present in an intron that functions as a 5 'splice site in the presence of a compound described herein. The intronic REMS,
[00305] [00305] In this specification, a "non-endogenous" nucleotide sequence (such as a non-endogenous 5 'splice site, a non-endogenous branch point or a non-endogenous 3' splice site) is a naturally occurring nucleotide sequence as part of a pre-RNA or DNA sequence encoding a pre-RNA sequence. In other words, the man's hand is needed to synthesize or manipulate the RNA or DNA sequence and introduce the nucleotide sequence.
[00306] [00306] In this specification, the term "non-endogenous intronic REMS" refers to a REMS sequence not found naturally as part of an RNA sequence or naturally encoded by a DNA sequence. In other words, the man's hand is needed to synthesize or manipulate the RNA or DNA sequence and introduce the intronic REMS or the nucleotide sequence that encodes the intronic REMS.
[00307] [00307] In this specification, the terms "intron-derived exon", "intronic exon", "iExon" and "intronic exon" (collectively iExon) refer to an exon that is produced from an intronic RNA sequence when an intronic REMS sequence, a branching point, a 3 "splice site and a splicing modifying compound are present. In particular, when RNA splicing of an RNA transcript comprising two exons and an intron occurs in the presence of a compound described here, in which a first exon is upstream of the intron and a second exon is downstream of the intron, with the intron comprising in the 5 'to 3' direction: a first splice site 5 ', a first branching point , a first 3 'splice site, an iREMS, a second branch point and a second 3' splice site, a resulting iExon comprises the following RNA sequence: the RNA sequence between the first 3 'splice site and the iREMS (corresponding to iExon la as shown in F Figure 1A). One or more of the intronic REMS sequence, the branching point and the 3 'splice site can be naturally present in an intronic RNA sequence or can be introduced into the intronic RNA sequence. When all such elements are present or are introduced, in the presence of a compound described here, the elements define an exonic limit that allows the splicing machinery to generate an iExon in the RNA, a result that would not occur naturally without the addition of a modifying compound splicing.
[00308] [00308] In this specification, the term "pseudoexon" refers to known endogenous intronic sequences naturally present in introns encoded by DNA that can match those of a branching point, a splice site 3 'and a splice site 5 ', but which, nevertheless, are not active in the splicing process, neither processed nor present in the mature mMRNA. Some pseudoexons contain an intronic REMS at their 5 "splice sites. There is no known pseudoexon containing intronic REMS that is endogenously recognized by the splicing machinery for producing an iExon, but in the presence of a splicing-modifying compound as described here, splicing machinery produces an iExon, so the production of an iExon from a pseudoexon aims to be included in the scope of various aspects of the collective term “iExon”.
[00309] [00309] In this specification, the term "unnotated exon" refers to endogenous sequences that are naturally present as exons in the mature mRNA product according to experimental evidence, but which are not noted in the NCBI's RefSeg database (https : //www.ncbi.nlm.nih.gov/refsega/). Some unnotated exons contain an intronic REMS at the 5 'splice site. An unnotated exon containing REMS is not known to be endogenously recognized by the splicing machinery for producing an iExon, but in the presence of a splicing-modifying compound as described herein, the splicing machinery produces an iExon. Thus, the production of an iExon from an unnotated exon aims to be included in the scope of several aspects of the collective term “iExon”.
[00310] [00310] In this specification, the terms "extended exon" (ie eExon) refer to an exon that includes an exon and a portion of an adjacent intronic sequence when an intronic REMS sequence, a branch point, a splice site 3 'and a splice modifying compound are present in, e.g. , the order shown in Figure 1B. In particular, when RNA splicing of an RNA transcript comprising two exons and an intron occurs in the presence of a compound described herein, where a first exon is upstream of the intron and a second exon is downstream of the intron, with the The intron comprises in the 5 to 3 'direction: a 5' splice site, an iREMS, a branch point and a 3 'splice site, with neither a branch point nor a 3' splice site interfering between the sequence of iREMS and the 5 'splice site, a resulting eExon comprises the first exon and the RNA sequence between the 5 "splice site and the intronic REMS (corresponding to Exon le, as shown in Figure 1B, and Exon 2e as shown in Figure 1C).
[00311] [00311] In this specification, the term "substantial variation" in the context of the amount of one or more RNA transcripts (eg, rRNA, tRNA, miRNA, siRNA, piRNA, IncRNA, pre-mRNA or mRNA transcripts) , a variant of alternative splicing of these or an isoform of these, or one or more proteins of this, each expressed as the product of one or more genes, means that the quantity of such products varies by a statistically significant amount as, in an example not limiting, a p-value less than a value selected from 0.1; 0.01; 0.001 or 0.0001.
[00312] [00312] In this specification, the terms "individual" and "patient" are used interchangeably to refer to an animal or any living organism that has sensations or the power of voluntary movements, and that requires oxygen and organic food for its existence. Non-limiting examples include members of the human, equine, swine, rat, murine, canine and feline species. In some ways, the individual is a warm-blooded vertebrate mammal or animal. In some ways, the individual is not an animal human. In specific aspects, the individual is human.
[00313] [00313] In this specification, the term "functional protein" refers to a form of protein that retains a particular biological function or the functions of a complete protein or isoforms of the protein encoded by a gene.
[00314] [00314] In this specification, the term "non-functional protein" refers to a form of protein that does not retain any biological function when compared to the complete protein or an isoform of the protein encoded by a gene in the absence of a splicing-modifying compound as described here.
[00315] [00315] In this specification, in the context of a functional protein produced from an artificial construct, the term "produces substantially less" means that the amount of functional protein produced in the presence of a compound described herein is at least substantially 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% less than than the amount of functional protein produced in the absence of the compound.
[00316] [00316] In another aspect, the invention provides methods for determining whether it is likely that the splicing of the precursor RNA of a gene will be modified by a compound of Formula (I) or a form thereof, which comprises researching the presence of a REMS intronic (that is, a sequence functioning as a 5 'splice site that responds to the presence of compound) in an intronic gene sequence, in which the presence of intronic REMS, the 3' splice site and an intronic branching point the sequence of the gene indicates that the splicing of the precursor RNA of the gene is likely to be modified by the compound of Formula (I) or a form thereof, and the absence of intronic REMS and an intronic 3 'splice intronic site and a dot of intronic branching in the gene sequence indicates that the splicing of the precursor RNA of the gene is likely to be modified by the compound of Formula (1) or a form thereof. In specific aspects, the methods also include searching for the presence of the combination of an intronic REMS, an intronic 3 'splice site and an intronic branching point in the gene sequence.
[00317] [00317] In another aspect, the invention provides methods for determining whether the quantity of a product (e.g., an mRNA or protein transcript) in a gene is likely to be modulated by a compound of Formula (I) or a form, which comprises researching the presence of an intronic REMS in the sequence of the gene, in which the presence of the combination of an intronic REMS, an intronic splice site 3 "and an intronic branching point in the sequence of the gene indicates that it is It is likely that the amount of a product (eg, an mRNA or protein transcript) of the gene will be modulated by the compound of Formula (1) or a form thereof, and the absence of the combination of an intronic REMS, a site of intronic 3 'splice and an intronic branching point in the gene sequence indicates that the amount of a product (eg, an mRNA or protein transcript) in the gene is not likely to be modulated by the compound of Formula (1) or In a specific way, the methods also include pe search for the presence of any one of an intronic REMS, an intronic 3 'splice site and an intronic branching point in the gene sequence. In specific aspects, the methods also include searching for the presence of the combination of an intronic REMS, a branching point downstream and a splice site 3 'downstream in the gene sequence.
[00318] [00318] The step of searching for the presence of the minimally necessary combination of an intronic REMS, a splice site 3 'downstream and a branch point downstream following the gene described here can be performed by a computerized system comprising instructions for storage of memory in the search for the presence of the combination in the gene sequence, or such search can be performed manually.
[00319] [00319] In certain aspects, the splicing of a precursor RNA containing an intronic REMS is evaluated by placing a compound described here in contact with the precursor RNA in cell culture. In some respects, the splicing of a precursor RNA containing an intronic REMS is evaluated by placing a compound described here in contact with the precursor RNA in a cell-free extract. In a specific aspect, the compound is the one known to modulate the splicing of a precursor RNA containing an intronic REMS. See, p. eg, the section below on methods for determining whether a compound modulates the expression of certain genes and the example below for techniques that could be used in these assessments.
[00320] [00320] The invention provides methods for determining whether a compound of Formula (1) or a form thereof modulates the amount of one, two, three or more RNA transcripts (e.g., transcripts or of P-pre-mRNA or mRNA or isoforms thereof) of one, two, three or more genes. In some ways, the gene is any of the genes described here.
[00321] [00321] In one aspect, the invention provides a method for determining whether a compound of Formula (I) or a form thereof modulates the amount of an RNA transcript, comprising: (a) contacting one or more cells with a compound of Formula (I) or a form thereof, and (b) determining the amount of the RNA transcript produced by the cell (s), wherein the modulation in the amount of the RNA transcript in the presence of the compound, relative to the amount of the RNA transcript in the absence of the compound or the presence of a negative control (eg, a vehicle control such as PBS or DMSO), indicates that the compound of Formula (1) or a form thereof modulates the amount of the RNA transcript. In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modulates the amount of an RNA transcript (e.g., an mMRNA transcript), comprising: (a) placing one or more first cells in contact with a compound of Formula (I) or a form thereof, (b) placing one or more second cells in contact with a negative control (eg, a vehicle control, such as PBS or DMSO); and (c) determining the amount of the RNA transcript produced by the first cell (s) and the second cell (s); and (d) comparing the amount of the RNA transcript produced by the first cell (s) with the amount of the RNA transcript expressed by the second cell (s), in which the modulation in the amount of the RNA transcript produced by the first cell (s), relative to the amount of the RNA transcript produced by the second cell (s), indicates that the compound of Formula (1) or a form thereof modulates the amount of the RNA transcript. In certain aspects, contact of the cell (s) with the compound occurs in cell culture. In other respects, contact of the cell (s) with the compound occurs in an individual, such as a non-human animal.
[00322] [00322] In another aspect, the invention provides a method for determining whether a compound of Formula (I) or a form thereof modifies the splicing of an RNA transcript (e.g., an mRNA transcript), comprising: ( a) to grow one or more cells in the presence of a compound of Formula (TI) or a form thereof; and (b) determining the amount of the two or more splicing variants of the RNA transcript produced by the cell (s), wherein the modulation in the amount of the two or more RNA transcripts in the presence of the compound, in relation to the amount of two or more splicing variants of the RNA transcript in the absence of the compound or the presence of a negative control (eg, a vehicle control such as PBS or DMSO), indicates that the compound of Formula (1) or a its shape modifies the splicing of the RNA transcript.
[00323] [00323] In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modifies the splicing of an RNA transcript (e.g., an mRNA transcript), comprising: ( a) culturing one or more cells in the presence of a compound of Formula (LI) or a form thereof; (b) isolating splice variants from the RNA transcript of the cell (s) after a certain period of time; and (c) determining the amount of splicing variants of the RNA transcript produced by the cell (s), wherein the modulation in the amount of the two or more RNA transcripts in the presence of the compound, relative to the amount of the splicing of the RNA transcript in the absence of the compound or the presence of a negative control (eg, a vehicle control such as PBS or DMSO), indicates that the compound of Formula (1) or a form thereof modifies the splicing of the RNA transcript.
[00324] [00324] In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modulates the amount of an RNA transcript (e.g., an mRNA transcript), comprising: ( a) placing a cell-free system in contact with a compound of Formula (1) or a form thereof, and (b) determining the amount of the RNA transcript produced by the cell-free system, with modulation in the amount of the transcript of RNA in the presence of the compound, relative to the amount of the RNA transcript in the absence of the compound or the presence of a negative control (eg, a vehicle control such as PBS or DMSO), indicates that the compound of Formula (1 ) or a form of it modulates the amount of the RNA transcript. In another aspect, the invention provides a method for determining whether a compound of Formula (I) or a form thereof modulates the amount of an RNA transcript (e.g., an MRNA transcript), comprising: (a) placing a first cell-free system in contact with a compound of Formula (1) or a form thereof, (b) placing a second cell-free system in contact with a negative control (eg, a vehicle control, such as PBS or DMSO); and (c) determining the amount of the RNA transcript produced by the first cell-free system and the second cell-free system; and (d) comparing the amount of the RNA transcript produced by the first cell-free system with the amount of the RNA transcript expressed by the second cell-free system, where modulation in the amount of the RNA transcript produced by the first cell-free system , in relation to the amount of the RNA transcript produced by the second cell-free system, indicates that the compound of Formula (II) or a form thereof modulates the amount of the RNA transcript. In certain aspects, the cell-free system comprises purely synthetic RNA, synthetic or recombinant (purified) enzymes and protein factors. In other respects, the cell-free system comprises RNA transcribed from a template of synthetic DNA, synthetic or recombinant (purified) enzymes and protein factors. In other respects, the cell-free system comprises purely synthetic RNA and nuclear extract. In other respects, the cell-free system comprises RNA transcribed from a synthetic DNA template and nuclear extract. In other respects, the cell-free system comprises purely synthetic RNA and whole cell extract. In other respects, the cell-free system comprises RNA transcribed from a synthetic DNA template and whole cell extract. In certain respects, the cell-free system additionally comprises regulatory RNAs (eg, microRNAs).
[00325] [00325] In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modifies the splicing of an RNA transcript (e.g., an mRNA transcript), comprising: ( a) placing a cell-free system in contact with a compound of Formula (I) or a form thereof; and (b) determining the number of splicing variants of the RNA transcript produced by the cell-free system, wherein modulation in the number of splicing variants of the RNA transcript in the presence of the compound, relative to the number of splicing variants of the RNA transcript in the absence of the compound or the presence of a negative control (eg, a vehicle control such as PBS or DMSO), indicates that the compound of Formula (II) or a form thereof modifies the splicing of the transcript of RNA.
[00326] [00326] In another aspect, the invention provides a method for determining whether a compound of Formula (I) or a form thereof modulates the amount of an RNA transcript (e.g., an mRNA transcript), comprising: ( a) culturing one or more cells in the presence of a compound of Formula (TI) or a form thereof, (b) isolating the RNA transcript from the cell (s) after a certain period of time; and (c) determining the amount of the RNA transcript produced by the cell (s), wherein the modulation in the amount of the RNA transcript in the presence of the compound, relative to the amount of the RNA transcript in the absence of the compound or the presence of a negative control (eg, a vehicle control such as PBS or DMSO), indicates that the compound of Formula (1) or a form thereof modulates the amount of the RNA transcript. In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modulates the amount of an RNA transcript (e.g., an mMRNA transcript), comprising (a) culturing a or more first cells in the presence of a compound of Formula (I) or a form thereof, (b) culturing one or more second cells in the presence of a negative control (eg, a vehicle control, such as PBS or
[00327] [00327] In certain respects, the cell (s) placed in contact or cultured (s) with a compound of Formula (1) or a form thereof is / are one or more primary cells of an individual . In some respects, the cell (s) placed in contact or cultured with a compound of Formula (1) or a form thereof is / are one or more primary cells of an individual with a disease . In specific aspects, the cell (s) placed in contact or cultured with a compound of Formula (I) or a form thereof is / are one or more primary cells of an individual with a disease associated with an abnormal amount of RNA transcript (s) for particular gene (s). In some specific respects, the cell (s) brought into contact or cultured with a compound of Formula (1) or a form thereof is / are one or more primary cells of an individual with a disease associated with an abnormal amount of a particular gene isoform (s). In some respects, the cell (s) brought into contact with or cultured with a compound of Formula ( 1) or a form thereof is / are a fibroblast (eg, GMO3813 or PNN 1-46 fibroblasts), an immune cell (eg, a T cell, B cell, natural killer cell, macrophage) or a muscle cell In some respects, the cell (s) brought into contact with or cultured with a compound of Formula (I) or a form thereof is / are a cancer cell.
[00328] [00328] In certain respects, the cell (s) placed in contact or cultured (s) with a compound of Formula (1) or a form thereof is / are from a cell line. In some respects, cell (s) placed in contact or cultured with a compound of Formula (I) or a form thereof is / are a cell line derived from an individual with a disease. In certain respects, the cell (s) placed in contact with or cultured (s) with a compound of Formula (TI) or a form thereof is / are from a cell line known to have abnormal levels of transcripts of RNA for particular gene (s). In specific aspects, the cell (s) placed in contact with or cultured with a compound of Formula (1) or a form thereof is / are from a cell line derived from an individual with a disease known to have abnormal levels of RNA transcripts for particular gene (s). In certain respects, the cell (s) brought into contact with or cultured with a Formula (I) compound or a form thereof is / are a cancer cell line.
[00329] [00329] In some specific aspects, cell (s) placed in contact or cultured with the compound of Formula (1) or a form thereof is / are from a cell line derived from an individual with a disease known to have an abnormal amount of an RNA isoform (s) and / or gene protein (s) isoform (s) in particular. Non-limiting examples of cell lines include 3T3, 4Tl, 721, 9L, A2780, Al72, A20, A253, A431, A-549, ALC, Bl6, B35, BCP-1, BEAS-2B, bEnd.3, BHK, cells BR 293, BT20, BT483, BxPC3, C2Cl2, C3H-10T1 / 2, c6 / 36, C6, Cal-27, CHO, COR-L23, COS, COV-434, CML Tl, CMT, CRL7030, CT26, Dl7, DH82, DUl45, DuCaP, EL4, EM2, EM3, EMT6, FM3, H1299, H69, HB54, HB55, HCA2, HD-1994, HDF (human dermal fibroblasts), HEK-293, HeLa, Hepalclc7, HL-60, HMEC , Hs578T, HsS78Bst, HT-29, HTB2, HUVEC, Jurkat, J558L, JY, K562, Ku812, KCL22, KGl, KYOl, LNCap, Ma-Mel, MC-38, MCF-7, MCF-10A, MDA-MB -231, MDA-MB-468, MDA-MB-435, MDCK, MG63, MOR / 0.2R, MONO-MAC 6, MRC5, MTD-1A, NCI-H69, NIH-3T3, NALM-1, NSO, NW -145, OPCN, OPCT, PNT-1A, PNT-2, Raji, RBL, RenCa, RIN-5F, RMA, Saos-2, Sf21, Sf9, SH-SY5Y, SiHa, SKBR3, SKOV-3, T2, T -47D, T84, THPl, U373, U87, U937, VCaP, Vero, VERY, W138, WM39, WT-49, X63, YAC-1 and YAR. In one aspect, the cells are from a patient. In another aspect, the patient's cells are GMO3813 cells. In another aspect, the patient's cells are GMO4856, GMO4857, GMO9197, GMO4281, GMO4022, GMO07492 cells.
[00330] [00330] In another aspect, the invention provides a method for determining whether a compound of Formula (II) or a form thereof modulates the amount of an RNA transcript (e.g., an mMRNA transcript), comprising: ( a) placing a tissue sample in contact with a compound of Formula (1) or a form thereof; and (b) determining the amount of the RNA transcript produced by the tissue sample, where the modulation in the amount of the RNA transcript in the presence of the compound, in relation to the amount of the RNA transcript in the absence of the compound or the presence of a control negative (e.g., a vehicle control such as PBS or DMSO), indicates that the compound of Formula (1) or a form thereof modulates the amount of the RNA transcript. In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modulates the amount of an RNA transcript (eg, an MRNA transcript), comprising: (a) placing a first tissue sample in contact with a compound of Formula (1) or a form thereof, (b) placing a second tissue sample in contact with a negative control (eg, a vehicle control, such as PBS or DMSO); and (c) determining the amount of the RNA transcript produced by a first tissue sample and the second tissue sample; and (d) comparing the amount of the RNA transcript produced by the first tissue sample with the amount of the RNA transcript produced by the second tissue sample, where the modulation in the amount of the RNA transcript produced by the first tissue sample, in relation to the amount of the RNA transcript produced by the second tissue sample, indicates that the compound of Formula (1) or a form thereof modulates the amount of the RNA transcript. Any tissue sample containing cells can be used according to these methods. In some ways, the tissue sample is a blood sample, a skin sample, a muscle sample, or a tumor sample. Techniques known to the person skilled in the art can be used to obtain a tissue sample from an individual.
[00331] [00331] In some aspects, a dose-response test is performed. In one aspect, the dose-response assay comprises: (a) bringing one or more cells into contact with a concentration of a compound of Formula (I) or a form thereof; (B)
[00332] [00332] In one aspect, the dose-response assay comprises: (a) placing one or more cells in contact with a concentration of a compound of Formula (1) or a form thereof, in which the cells are within the cavities a cell culture vessel (eg, a 96-well plate), at approximately the same density within each well, with the cells being brought into contact with different concentrations of the compound in different wells; (b) isolating the RNA from said cells in each well; (c) determining the amount of the RNA transcript produced by the cell (s) in each well; and (d) evaluate the variation in the amount of the RNA transcript in the presence of one or more concentrations of the compound, in relation to the amount of the RNA transcript in the presence of a different concentration of the compound or in the absence of the compound or the presence of a control negative (eg a vehicle control such as PBS or DMSO).
[00333] [00333] In certain aspects, the contact of the cell (s) with the compound occurs in cell culture. In other respects, contact of the cell (s) with the compound occurs in an individual, such as a non-human animal.
[00334] [00334] In certain aspects described here, the cell (s) is / are contacted (s) or cultured (s) with a compound of Formula (1) or a form thereof, or a sample of tissue is placed in contact with a Formula (TI) compound, or a form thereof, or with a negative control for a period of 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours,
[00335] [00335] In certain aspects described herein, the cell (s) is / are brought into contact or cultured (s) with a certain concentration of a compound of Formula (1) or a form thereof, or a tissue sample is placed in contact with a given concentration of a compound of Formula (1) or a form thereof, where the given concentration is 0.0001 µM, 0.0003 µM, 0.001 µM, 0.003 µM, 0, 01 pM, 0.05 pM, 1 puM, 2 pM, 5 µM, 10 µM, 15 µM, 20 µM, 25 µM, 50 µM, 75 µM, 100 µM or 150 µM. In other aspects described here, the cell (s) is / are contacted or cultured with a certain concentration of a compound of Formula (1) or a form thereof, or a sample of tissue is placed in contact with a certain concentration of a Formula (TI) compound or a form thereof, where the given concentration is 0.0001 µM, 0.0003 µM, 0.0005 µM, 0.001 µM, 0.003 µM, 0.005 puM, 0.01 pM, 0.03 µM, 0.05 µM, 0.1 µM, 0.3 pM, 0.5 puM or 1 µM. In other aspects described here, the cell (s) is / are contacted or cultured (s) with a certain concentration of a compound of Formula (I) or a form thereof, or a sample of tissue is brought into contact with a certain concentration of a compound of Formula (I) or a form thereof, where the given concentration is 175 µM, 200 µM, 250 µM, 275 µM, 300 µM, 350 µM, 400 µM, 450 µm, 500 µm, 550 µm, 600 µM, 650 µm, 700 µM, 750 µm, 800 µM, 850 µM, 900 µM, 950 µM or 1 mM. In some aspects described here, the cell (s) is / are contacted or cultured (s) with a certain concentration of a compound of Formula (1) or a form thereof, or a sample of tissue is placed in contact with a given concentration of a compound of Formula (I) or a form thereof, where the given concentration is 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM , 800 nM, 850 nM, 900 nM, or 950 nM. In certain aspects described here, the cell (s) is / are brought into contact or cultured (s) with a certain concentration of a compound of Formula (I) or a form thereof, or a sample of tissue is brought into contact with a given concentration of a compound of Formula (I) or a form thereof, where the given concentration is between 0.0001 µM and 0.001 µM, 0.0001 µM and 0.01 µM, 0, 0003 puM and 0.001 puM, 0.0003 µM and 0.01 µM, 0.001 puM and 0.01 µM, 0.003 µM and 0.01 µM, 0.01 puM and 0.1 µM, 0.1 µM and 1 µM, 1 1puMe 50 µM, 50 µM and 100 µM, 100 µM and 500 µM, 500 µM and 1 nM, 1 nM and 10 nM, 10 nM and 50 nM, 50 nM and 100 nM, 100 nM and 500 nM, 500 nM and 1000 nM.
[00336] [00336] In another aspect, the invention provides a method for determining whether a compound of Formula (1) or a form thereof modulates the amount of an RNA transcript (e.g., an mRNA transcript), comprising: ( a) administering a compound of Formula (1) or a form thereof to an individual (in some respects, a non-human animal); and (b) determining the amount of the RNA transcript in a sample obtained from the individual, where the modulation in the amount of the RNA transcript measured in the sample of the individual who received the compound or its form, in relation to the amount of the RNA transcript in a sample from the individual, prior to administration of the compound or its form, or a sample from a different individual of the same species that has not received the compound or its form, indicates that the compound of Formula (1) or a form of the same modulates the amount of the RNA transcript.
[00337] [00337] In another aspect, the invention provides a method for determining whether a compound of Formula (I) or a form thereof modifies the splicing of an RNA transcript (e.g., an mMRNA transcript), comprising: ( a) administering a compound of Formula (I) or a form thereof to an individual (in some respects, a non-human animal); and (b) determining the number of splicing variants of the RNA transcript in a sample obtained from the individual, wherein the modulation in the number of splicing variants of the RNA transcript measured in the sample of the individual receiving the compound or its form, in with respect to the number of splicing variants of the RNA transcript in a sample from the individual prior to administration of the compound or its form or a sample from a different individual of the same species that did not receive the compound or its form, indicates that the compound of Formula (I) or a form thereof modifies the splicing of the RNA transcript. In other respects, the invention provides a method for determining whether a compound of Formula (I) or a form thereof modifies the splicing of an RNA transcript (e.g., an mRNA transcript), comprising: (a) administering a compound of Formula (I) or a form thereof to a first individual (in some respects, a non-human animal); (b) administering a negative control (eg, a pharmaceutical carrier) to a second individual (in some respects, a non-human animal) of the same species as the first individual; (c) determining the number of splicing variants of the RNA transcript in a first tissue sample from the first individual and the number of splicing variants of the RNA transcript in the second tissue sample from the second individual; and (d) comparing the quantity of the RNA transcript splicing variants in the first tissue sample with the quantity of the RNA transcript splicing variants in the second tissue sample, wherein modulation in the quantity of the RNA transcript splicing variants in the first tissue sample. RNA in the first tissue sample, relative to the number of splicing variants of the RNA transcript in the second tissue sample, indicates that the compound of Formula (I) or a form thereof modifies the splicing of the RNA transcript. In certain respects, a compound of Formula (1) or a form thereof is administered to an individual at a dose between approximately 0.001 mg / kg / day and 500 mg / kg / day. In some respects, a single dose of a compound of Formula (1) or its form is administered to an individual according to the methods described herein. In other respects, 2, 3, 4, 5 or more doses of a compound of Formula (I) are administered to an individual according to the methods described herein. In specific aspects, the compound of Formula (I) or its form is administered to an individual in a pharmaceutically acceptable vehicle, excipient or diluent.
[00338] [00338] In some respects, the compound of Formula (LI) or its form that is brought into contact with or cultured with cell (s) or a tissue sample, or administered to an individual is a compound described herein.
[00339] [00339] Techniques known to those skilled in the subject can be used to determine the amount of RNA transcript (s). In some respects, the amount of one, two, three or more RNA transcripts is measured using deep sequencing, such as ILLUMINAº RNASegq, next generation sequencing (NGS ILLUMINA , Next generation sequencing ION TORRENT! "RNA, pyro sequencing 4547 ”Or Sequencing by oligonucleotide detection and ligation (Sequencing Oligo Ligation Detection, SOLID '" "), real-time single molecule (SMRT) sequencing, nanoporous sequencing. In other respects, the amount of multiple RNA transcripts is measured using an array of exons, such as the geneCHIPº human exon array. In certain respects, the amount of one, two, three or more RNA transcripts is determined by RT-PCR. In other respects, the amount of one, two, three or most RNA transcripts are measured by RT-qPCR or color-coded digital color bar code technology.The techniques for conducting these assays are known to the person skilled in the art.
[00340] [00340] In some aspects, analysis is performed on data derived from the assay to measure the magnitude of the splicing and determine the amount of exons processed (spliced) in an mRNA transcript that is produced in the presence of the compound in relation to the amount in the absence of the compound or presence of a negative control. In a preferred aspect, the method used is the calculation of the variation in Percent Spliced In (APSI). The method uses data read from RNAseq (or any other method that can distinguish splicing isoforms from mMRNA) to calculate the ratio (percentage) between readings that demonstrate inclusion (junctions between the upstream exon and the exon of interest) or exclusion (junction between exons upstream and downstream, excluding the exon of interest), to demonstrate whether the presence of the compound affects the number of exons included in relation to the number of included in the absence of the compound or in the presence of a negative control.
[00341] [00341] The APSI value is derived from the formula: APSI (%) = C - U x100 Where “U” represents the value for the probability of including iExon (at + b) / 2 / [(a + b) / 2 + c] in the absence of the compound; and where “CC” represents the value for the probability of including iExon (at + b) / 2 / [(at + b) / 2 + c] in the presence of the compound. The values for “a” and “W” represent the number of readings supporting the inclusion of an iExon in an RNA transcript. In other words, the value of "a" is derived from the number of readings for a first intronic nucleotide sequence comprising, in the 5 'to 3 "direction: a first 5' exon splice site, operationally linked and upstream of a first intronic nucleotide sequence comprising a first branch point operatively linked yet upstream of a first intronic 3 'splice site (upstream of the nascent iExon). The “DD” value is derived from the number of readings for a second sequence nucleotide sequence comprising, in the 5 'to 3' direction: a REMS sequence operably linked and upstream of a second intronic sequence of nucleotides comprising a second branching point operatively linked further upstream of a second intronic 3 "splice site of a second exon. The “c” value represents the number of readings supporting the exclusion of an iExon. Thus, when a compound allows the splicing machinery to recognize a nascent iExon, the value of “C” in the presence of the splicing that modulates the compound will be different from the value of “U” in the absence of the compound. The statistically significant value for the probability of including iExon can be obtained according to statistical analysis methods or other methods for probability analysis known to those skilled in the art.
[00342] [00342] In some respects, a statistical analysis or other probability analysis is performed on the test data used to measure an RNA transcript. In certain aspects, for example, a statistical analysis is performed with Fisher's Exact Test, comparing the total number of readings for inclusion and exclusion of an iExon (or region) based on data from one or more tests used to measure whether the amount of an RNA transcript is modulated in the presence of the compound relative to the amount in the absence of the compound or in the presence of a negative control. In specific aspects, statistical analysis results in a confidence value for those modulated RNA transcripts of 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0, 01%, 0.001% or 0.0001%. In some specific respects, the confidence value is a Pp value for those modulated RNA transcripts of 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0, 01%, 0.001% or 0.0001%. In certain specific respects, an exact test, Student's t-test or p-value for those modulated RNA transcripts is 10%, 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1% and 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001% or 0.0001%, respectively.
[00343] [00343] In certain respects, a more detailed analysis is performed to determine how the compound of Formula (I) or a form thereof is changing the amount of RNA transcript (s). In specific aspects, a more detailed analysis is performed to determine whether the modulation in the amount of RNA transcript (s) in the presence of a compound of Formula (1) or its form, in relation to the amount of the RNA transcript (s) in the absence of the compound or its form, or in the presence of a negative control, it is due to variations in the transcription, splicing and / or stability of the RNA transcript (s). Techniques known to the person skilled in the art can be used to determine whether a compound of Formula (II) or a form thereof changes, e.g. , transcription, splicing and / or stability of RNA transcript (s).
[00344] [00344] In certain respects, the stability of one or more RNA transcripts is determined by serial analysis of gene expression (SAGE), analysis of differential expression (DD, differential display), PCR with arbitrary RNA primers (RAP) analysis of sequences differentially expressed with restriction-lytic endonuclease (restriction endonuclease-lytic analysis of differentially expressed sequences, READS) polymorphism in amplified restriction fragment-length polymorphism, ALFP, total gene expression analysis (TOGA), RT-PCR, RT-RPA (recombinase polymerase amplification), RT-qPCR, RNA-Seq, color-coded digital barcode technology, hybridization analysis with high-density cDNA filter hybridization analysis , HDFCA), subtractive suppression hybridization (SSH), differential scanning (differential screening, DS), cDNA arrays, oligonucleotide chips or microarrays of fabrics. In other respects, the stability of one or more RNA transcripts is determined by Northern blot, RNase protection or slot blot.
[00345] [00345] In some respects, transcription in cell (s) or tissue sample is inhibited before (e.g., 5 minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours , 12 hours, 18 hours, 24 hours, 36 hours, 48 hours or 72 hours before) or after (eg, 5 minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours or 72 hours later) that the cell or tissue sample is brought into contact with or cultured with a transcription inhibitor, such as α-amanitin, DRB, flavopyridol, triptolide or actinomycin-D. In other respects, transcription in a cell (s) or tissue sample is inhibited with a transcription inhibitor, such as α-amanitin, DRB, flavopyridol, triptolide or actinomycin-D, while the cell (s) or tissue sample is / are brought into contact with or grown with a compound of Formula (1) or its form.
[00346] [00346] In certain respects, the level of transcription of one or more RNA transcripts is determined by a run-on nuclear assay or an in vitro transcription initiation and elongation assay. In some respects, the detection of transcription is based on the measured radioactivity or fluorescence. In some aspects, a PCR-based amplification step is used.
[00347] [00347] In specific aspects, the number of forms resulting from alternative splicing of the RNA transcripts of a particular gene is measured to see if there is modulation in the amount of one, two or more forms resulting from the alternative splicing of the RNA transcripts of the gene . In some respects, the amount of an isoform (s) encoded by a particular gene is measured to see if there is modulation in the amount of the isoform (s). In some respects, the levels of spliced forms of RNA are quantified by RT-PCR, RT-qPCR, RNA-Segq, color-coded digital barcode technology or Northern blot. In other respects, sequence-specific techniques can be used to detect the levels of an individual spliceoform. In certain aspects, splicing is measured in vitro using nuclear extracts. In some respects, detection is based on measuring radioactivity or fluorescence. Techniques known to those skilled in the subject can be used to measure modulation in the number of forms resulting from alternative splicing of a gene's RNA transcript and modulation in the amount of an isoform encoded by a gene. Pharmaceutical compositions and modes of administration
[00348] [00348] When administered to a patient, a compound of Formula (1) or a form thereof is preferably administered as a component of a composition optionally comprising a pharmaceutically acceptable carrier, excipient or diluent. The composition can be administered orally or by any other convenient route, for example, by infusion or bolus injection, by absorption through the epithelial or mucocutaneous lining (eg, oral, rectal and intestinal mucosa) and can be administered along with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g. e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, and can be used to administer the compound.
[00349] [00349] Methods of administration include, but are not limited to, parenteral, intradermal, intramuscular, intraperitoneal,
[00350] [00350] The amount of a compound of Formula (LI) or its form that will be effective in treating a disease resulting from an abnormal amount of mRNA transcripts depends, e.g. , the route of administration, the disease being treated, the individual's general condition, ethnicity, age, weight and sex of the individual, diet, time and severity with which the disease progresses, and should be decided according to the judgment of the doctor and the circumstances of each patient or individual.
[00351] [00351] In specific aspects, an "effective amount", in the context of administering a compound of Formula (1), or its form, or composition or medication thereof, refers to an amount of a compound of Formula (LI ) or its form for a patient that exhibits a therapeutic and / or beneficial effect. In certain specific respects, an "effective amount" in the context of administering a compound of Formula (1), or its form, or composition or drug thereof to a patient results in one, two or more of the following effects: (1) reduces or improves the severity of a disease; (ii) delays the onset of a disease; (iii) inhibits the progression of a disease; (iv) reduces an individual's hospitalization; (v) reduces an individual's hospitalization period; (vi) increases an individual's survival; (vii) improves an individual's quality of life; (viii) reduces the number of symptoms associated with a disease; (ix) reduces or improves the severity of a symptom (s) associated with a disease; (x) reduces the duration of a symptom associated with a disease; (xi) prevents the recurrence of a symptom associated with a disease; (xii) inhibits the development or onset of a disease symptom; and / or (xiii) inhibits the progression of a symptom associated with a disease. In certain respects, an effective amount of a Formula (I) compound or its form is an effective amount to restore the amount of a gene's RNA transcript to the amount of the detectable RNA transcript in healthy or cells of healthy [sic] patients. In other respects, an effective amount of a compound of Formula (TI) or its form is an effective amount to restore the amount of an RNA isoform and / or protein isoform of the gene to the amount of the RNA isoform and / or protein isoform detectable in healthy [sic] patients or healthy patient [sic] cells.
[00352] [00352] In certain respects, an effective amount of a compound of Formula (1) or its form is an effective amount to decrease the abnormal amount of a gene's RNA transcript that is associated with a disease. In certain respects, an effective amount of a compound of Formula (1) or its form is an effective amount to decrease the amount of abnormal expression of a gene isoform. In some respects, an effective amount of a compound of Formula (I) or its form is an effective amount to result in a substantial change in the amount of an RNA transcript (e.g., mMRNA transcript), splicing variant alternative or isoform.
[00353] [00353] In certain respects, an effective amount of a compound of Formula (1) or its form is an effective amount to increase or decrease the amount of an RNA transcript (e.g., an mRNA transcript) of the gene which is beneficial for the prevention and / or treatment of a disease. In certain respects, an effective amount of a compound of Formula (1) or its form is an amount effective to increase or decrease the amount of an alternative splicing variant of a gene RNA transcript that is beneficial for preventing and / or treating a disease. In certain aspects, an effective amount of a compound of Formula (1) or its form is an amount effective to increase or decrease the amount of an isoform of the gene that is beneficial for the prevention and / or treatment of a disease. Non-limiting examples of effective amounts of a compound of Formula (1) or its form are described herein.
[00354] [00354] For example, the effective amount may be the amount required to prevent and / or treat a disease associated with the abnormal amount of a gene mRNA transcript in a human.
[00355] [00355] In general, the effective amount will be in a range between approximately 0.001 mg / kg / day and 500 mg / kg / day for a patient weighing in a range between approximately 1 kg and 200 kg. The typical adult is supposed to have a median weight in the range between about 70 and 100 kg.
[00356] [00356] Within the scope of this description, the "effective amount" of a compound of Formula (I) or its form for use in the production of a drug, in the preparation of a pharmaceutical kit or in a method to prevent and / or treat a disease in a human being who needs it, must include an amount in the range between approximately 0.001 mg and 35,000 mg.
[00357] [00357] The compositions described herein are formulated for administration to the individual by any route known in the art for drug delivery. Non-limiting examples include oral, ocular, rectal, buccal, topical, nasal, ophthalmic, subcutaneous, intramuscular, intravenous (bolus and infusion), intracerebral, transdermal and pulmonary routes of administration.
[00358] [00358] Aspects described herein include the use of a compound of Formula (I) or its form in a pharmaceutical composition. In a specific aspect, the use of a compound of Formula (1) or its form in a pharmaceutical composition is described to prevent and / or treat a disease in a human being in need, comprising administering an effective amount of a compound of Formula (I), or its form, in admixture with a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the human being is a patient with a disease associated with an abnormal amount of mRNA transcript (s).
[00359] [00359] A compound of Formula (I) or its form may optionally be in the form of a composition comprising the compound, or its form, and an optional vehicle, excipient or diluent. Other aspects provided include pharmaceutical compositions comprising an effective amount of a compound of Formula (1), or its form, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the pharmaceutical compositions are suitable for veterinary and / or human administration. The pharmaceutical compositions can be in any form that allows the composition to be administered to an individual.
[00360] [00360] In a specific aspect and in this context, the term "pharmaceutically acceptable vehicle, excipient or diluent" means a vehicle, excipient or diluent approved by a regulatory agency of the Federal government or a state or listed in the American Pharmacopoeia or in another pharmacopoeia generally recognized for use in animals and, more particularly, in humans. The term "vehicle" refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete)), excipient or carrier with which a therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, of animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a specific vehicle for pharmaceutical compositions administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid vehicles, especially for injectable solutions.
[00361] [00361] Typical pharmaceutical compositions and forms comprise one or more excipients. Suitable excipients are well known to those skilled in the pharmacy field, and non-limiting examples of suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, clay, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene glycol, water, ethanol and the like. whether a particular excipient is suitable for incorporation into a pharmaceutical composition or pharmaceutical form depends on a variety of factors well known in the art, including, among others, the manner in which the pharmaceutical form will be administered to a patient and the specific active ingredients in the form pharmaceutical company. In addition, the invention provides pharmaceutical compositions and anhydrous pharmaceutical forms comprising one or more compounds of Formula (I) or their form described herein. Single unit dose compositions and forms can take the form of solutions or syrups (optionally with a flavoring agent), suspensions (optionally with a flavoring agent), emulsions, tablets (eg, chewable tablets), pills, capsules , granules, powder (optionally for reconstitution), formulations with masked or prolonged release flavor and the like.
[00362] [00362] Provided pharmaceutical compositions that are suitable for oral administration can be presented as distinct pharmaceutical forms, such as, among others, tablets, caplets, capsules, granules, powder and liquids. Such dosage forms contain predetermined amounts of active ingredients, and can be prepared by pharmacy methods well known to those skilled in the art.
[00363] [00363] Examples of excipients that can be used in oral dosage forms provided herein include, among others, binders, fillers, disintegrants and lubricants.
[00364] [00364] In one aspect, methods are described for modifying RNA splicing in order to modulate the amount of a gene product, in which a transcript of the transcribed precursor RNA of the gene contains an intronic REMS, and the methods use a compound described here . In certain respects, the gene is any of the genes described here. In some respects, the gene contains a nucleotide sequence that encodes a non-endogenous intronic REMS. In one aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the method comprises bringing a cell into contact with a compound Formula (I) or a form thereof.
[00365] [00365] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA transcript or a protein), wherein the gene comprises a sequence of DNA nucleotides encoding two exons and an intron, where the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, where the nucleotide sequence of the DNA encoding the intron comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a first 5 'splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3 'splice site, a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a second branch point and a se nucleotide sequence encoding a second 3 'splice site, in which the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, in which the method comprises placing a cell in contact with a compound described herein (for example, a compound of Formula (I) or a form thereof).
[00366] [00366] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript), wherein the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, where the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron , where the intron DNA nucleotide sequence comprises in the 5 'to 3 "direction: a nucleotide sequence encoding an iREMS, a nucleotide sequence encoding a branch point and a nucleotide sequence encoding a splice site 3 ', wherein the nucleotide sequence encoding the iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the method comprises placing air a cell in contact with a compound described herein (for example, a compound of Formula (LI) or a form thereof).
[00367] [00367] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript), wherein the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, the DNA nucleotide sequence encoding exonic and intronic elements illustrated in Figure 1A, in which the method comprises putting a cell in contact with a compound described here.
[00368] [00368] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript), wherein the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, the DNA nucleotide sequence encoding exonic and intronic elements illustrated in Figure 1B, in which the method comprises putting a cell in contact with a compound described here.
[00369] [00369] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript), wherein the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, and the nucleotide sequence of the DNA encodes exonic and intronic elements illustrated in Figure 1C, in which the method comprises putting a cell in contact with a compound described here.
[00370] [00370] In a specific aspect, the gene is a gene described in a table in this invention.
[00371] [00371] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, in which the precursor transcript, transcribed from gene comprises an intronic REMS, in which the method comprises putting a cell in contact with a compound of Formula (TI) or a form of it. In a specific aspect, the precursor transcript contains in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor transcript contains in the 5 'to 3' direction: a first 5 "splice site, a first branch point, a first 3 'splice site, an intronic REMS, a second branch point and a second 3 'splice site In another specific aspect the precursor transcript contains in the 5' to 3 'direction: an intronic REMS, a branch point and a 3' splice site.
[00372] [00372] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, in which the precursor transcript, transcribed from gene comprises an intronic REMS, in which the method comprises placing a cell in contact with a compound of Formula (I) or a form of it. In a specific aspect, the precursor transcript contains in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor transcript contains in the 5 'to 3' direction: a first splice site 5 ', a first branch point, a first splice site 3', an intronic REMS, a second branch point and a second splice site 3 ". In another specific aspect, the precursor transcript contains in the 5 'to 3' direction: an intronic REMS, a branch point and a 3 'splice site.
[00373] [00373] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, comprising placing a cell in contact with a compound of Formula (1) or a form thereof. See the examples section for additional information regarding the genes described here. In certain aspects, the cell is brought into contact with the compound of Formula (I) or a form of it in a cell culture. In other respects, the cell is brought into contact with the compound of Formula (TI) or a form of it in an individual (eg, a non-human animal or a human).
[00374] [00374] In one aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mRNA transcript containing an iExon from a pre-mRNA transcript, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 'to 3' direction: a first splice site 5 ', a first branching point, a first 3 'splice site, an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a second branch point and a second 3' splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide.
[00375] [00375] In one aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mRNA transcript containing an iExon, wherein the method comprises bringing a pre-mRNA transcript into contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises at 5 'to 3' direction: a first 5 "splice site, a first branch point, a first 3" splice site, an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a second branching and a second 3 'splice site, where iREMS comprises a sequence of GAgurngn RNA, where r is adenine or guanine and n is any nucleotide.
[00376] [00376] In another aspect, the invention provides a method for modifying RNA splicing to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre-mMRNA transcript in contact with a compound of Formula (II) or a form thereof, where the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron , where the intron comprises in the 5 '/ to 3' direction: a first splice site 5 ', a first branch point, a first splice site 3', an endogenous intronic splicing modifier (iREMS) recognition element or non-endogenous, a second branching point and a second 3 'splice site, wherein iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide. In some respects, the pre-mRNA transcript is encoded by a gene described here (eg, in a table).
[00377] [00377] In a particular aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mRNA transcript containing an iExon, wherein the method comprises placing a pre-mRNA transcript in contact with a compound of Formula (I) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which the intron comprises in the 5 "to 3 'direction: a first splice site 5', a first branch point, a first splice site 3 ', an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element, a second point branching and a second 3 'splice site, where iREMS comprises a sequence of GAgurngn RNA, where r is adenine or guanine and n is any nucleotide, the pre-mRNA transcript being a pre-mRNA transcript of a gene that is selected from ABCB8, ABCC3, ADAM 1I7, ADCY3, AGPAT4, ANKRA2, ANXAll, APIP, APPL2, ARHGAP1, ARL15, ASAP1, ASPH, ATAD2Z2B, ATXN1, BECN1l, BHMT2, BICD1, BTN3A1, Cllorf30, Cllorf73, Clor3, Ccl208 CASC3, CASP7, CCDCl22, CDH13, CECRT, CENPI, CEPl12, CEP192, CHEKl, CMAHP, CNRIPl, COPST7B, CPSF4, CRISPLD2, CRYBG3, CSNKIE, CSNKIGl, DCAFl7, DCUNIDND, DGF, DHD, ND3, DHX DNAJC13, DNMBP, DOCKI1, DYRKI1A, EIF2B3, ENAH, ENOXl, EP300, ERCl, ERLIN2, ERRFIl, EVC, FAF1, FAIM, FAMI26A, FAMI3A, FAMI62A, FAM174A, FBN2, FER, FHODC, GC, FOC GLCE, GOLGAl, GOLGBl, GPSM2, GULP1, GXYLT1, HDX, HLTF, HMGA2, HNMT, HSD1I7Bl2, HSDI7B4, HTT, IFT57, IVD, KDM6A, KIAALI524, KIAAI715, LM, LM, LM, LM MED13L, MEDAG, MEMOl, MFN2, MMS19, MRPL45, MRPS28, MTERF3, MYCBP2, MYLK, MYOF, NGF, NREP, NSUN4, NT5C2, OSMR, OXCTl, PAPD4, PCMl, PDE7A, PDS5B, PIXK3, PIKFYVE, PITPNB, PLEKHAl, PLSCRl1, PMS1, POMT2, PPARG, PPIP5SK2 , PPPIR26, PRPF3l, PRSS23, PSMA4, PXK, RAFl, RAPGEF1, RARS2, RBKS, RERE, RFWD2, RPAl, RPS10, SAMD4A, SARIA, SCOl, SEC24A, SENP6, SERGEF, SGK3, SLC12A2, SLC37, SLC , SNHGl16, SNX7, SOS2, SPATAS, SPIDR, SPRYD7, SRGAP1, SRRM1l, STATl, STXBP6, SUPT20H, TAF2, TASPl, TBC1IDI15, TCF12, TCF4, TIAMI, TJP2, TMC3, TME214, TNRC
[00378] [00378] In another particular aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 '/ to 3' direction: a first splice site 5 ', a first branch point, a first splice site 3 ", an intronic splicing modifier recognition element (iREMS ) endogenous or non-endogenous, a second branching point and a second 3 'splice site, in which iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre- mRNA is a pre-mRNA transcript of a gene that and is selected from ABCB8, ABCC3, ADAM17, ADCY3, AGPAT4, ANKRA2, ANXAll, APIP, APPL2, ARHGAPl, ARL15, ASAPI1, ASPH, ATAD2B, ATXNl, BECNl, BHMT2, BICDlI, BTN3Al, Cllor, 30 Cl4o0orfl32, C8orf44, C8orf44-SGK3, C8orfB88, CASC3, CASP7, CCDCl22, CDH13, CECR7, CENPI, CEP112, CEP192, CHEK1, CMAHP, CNRIP1l, COPST7B, CPSF4, CSNKI, CRISPLD2, CRISPL, DENNDIA, DENND5A, DGKA, DHFR, DIAPH3, DNAJC13, DNMBP, DOCKl, DYRKIA, EIF2B3, ENAH, ENOX1, EP300, ERCl, ERLIN2, ERRFIl, EVC, FAFl, FAIM, FAMI26A, FAMI13A, FAM162A, FAM742, FHOD3, FOCAD, GALC, GCFC2, GGACT, GLCE, GOLGA4, GOLGBl, GPSM2, GULPl, GXYLTl, HDX, HLTF, HMGA2,
[00379] [00379] In another particular aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 '/ to 3' direction: a first 5 'splice site, a first branching point, a first 3' splice site, an intronic splicing modifier recognition element (iREMS ) endogenous or non-endogenous, a second branching point and a second 3 'splice site, in which iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre- mRNA is a pre-mRNA transcript of a gene that and is selected from ABCAl, ABCAlO, ABCB7, ABCB8, ABCC1, ABCC3, ABHD10, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM12, ADAM1I5, ADAM1I7, ADAM23, ADAM33, ADAMTS1, ADAMTS19 ADDl, ADGRG6, ADH6, ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDCl, AHRR, AJUBA, AKO21888, AK310472, AKAP1, AKAP3, AKAP8SL, AKAP9, AKD, ALA, AKD ANK1, ANK2, ANK3, ANKFYl, ANKHDI-EIF4EBP3, ANKRA2, ANKRD13C, ANKRD17, ANKRD33B, ANKRD36, ANKS6, ANP32A, ANXAl1l, ANXA6, APZ2B1l, AP4AF1, ARHGAP1, ARHGAP12, ARHGAP22, ARHGAP5, ARHGEFl16, ARIDIA, ARID2, ARIDS5B, ARL9, ARL15, ARLSB, ARMCX3, ARMCX6, ARSJ, ASAP1l, ASIC1, ASL, ASNS, ASPH, ATG, ATF, ATG, ATF, ATG, ATF, ATG, ATF, ATG, ATG, ATF, ATG, ATF, AT5 ATPZ2A3, ATP2Cl, ATXN1, ATXN3, AURKA, AXINl, B3GALT2, B3GNT6, B4GALT2, BACEl, BAG2, BASPl, BCO033281, BCAR3, BCL2L15, BCYRNl, BECN1, BEND, B3, L3, B3, L3, B3, BIRC6, BNC1l, BNC2, BRCAl, BRCA2, BRD2, BRPFl, BSCL2, BTBD1O0O, BTG2, BTN3Al, BZWl, CIQTNF9B-AS1, Clorf27, Clorf8ê86, ClOorf54, Cllorf30, Cllorf70, Cllorf73, Cllorf76, Cllorf94, Cl20rf4, Cl20rf56, Cl40rf132, Cforf, C4, C4, c4r, C8orf34, C8orf44, C8orf44-SGK3, C8orf88, C90rf69, CAl3, CA3, CAB39, CACNAZD2, CACNBl, CACNBA4, CADM1, CADM2, CALU, CAMKK1l, CAND2, CAPNSl, CASC3, CASP7, CASV7, CASV7, CCDC88A, CCDC92, CCDC122, CCER2, CCNF, CCNL2, CCT6A, CD276, CD46, CDC25B, CDC40, CDC42BPA, CDCA7, CDH11, CDH13, CDHl18, CDKI11B, CDKl6, CDKALl, CDKNIC, CEN, CECRI CEPl62, CEP1I70, CEP192, CEP57, CEP68, CFH, CFLAR, CHD8, CHEKl, CHRM2, CIITA, CIZl, CLDN23, CLICl, CLK4, CLTA, CMAHP, CNGA4, CNOTl, CNRIP1l, CNTD1,
[00380] [00380] In another aspect in particular, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 'to 3' direction: a first splice site 5 ", a first branch point, a first splice site 3 ', an intronic splicing modifier recognition element (iREMS) endogenous or non-endogenous, a second branching point and a second 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, the pre-mRNA transcript being is a pre-mRNA transcript of a gene that is selected from APOA2Z, ASAP1, BRCAl, BRCA2, CDKNI1C, CRX, CTRC, DENND5A, DIAPH3, DMD, DNAH11, EIF2B3, GALC, HPS1, HTT, IKBKAP, KIAAl524, LMNA, MECP2, PAPDB, PAX, PAD , PTCH1, SLC34A3, SMN2, SPINK5, SREKl, TMEM67, VWF, XDH and XRN2.
[00381] [00381] In another particular aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 "to 3 'direction: a first splice site 5', a first branch point, a first splice site 3 ', an intronic splice modifier recognition element (iREMS) endogenous or non-endogenous, a second branching point and a second 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, the pre-mRNA transcript being is a pre-mRNA transcript of a gene that is selected from ABCAl, ABCAlIO, ABCB7, ABCB8, ABCC1, ABCC3, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS19, ADCY3, ADDL, ADGR6, ADGR6 , ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDCl1, AHRR, AJUBA, AKO21888, AK310472, AKAPl, AKAP3, AKAP8L, AKAP9, AKNA, ALCAM, ALDH4Al, ANKK2, ANPK2, , ANKHD1-EIF4EBP3, ANKRA2, ANKRD1I3C, ANKRD17, ANKRD33B, ANKRD36,
[00382] [00382] In another particular aspect, the invention provides a method for modifying RNA splicing to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre-transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 "to 3 'direction: a first splice site 5', a first branching point, a first splice site 3", an intronic splicing modifier recognition element (iREMS) endogenous or non-endogenous, a second branching point and a second 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, the pre-mRNA transcript being is a pre-mRNA transcript of a gene that it is not SMN2.
[00383] [00383] In another particular aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre-transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 "to 3 'direction: a first splice site 5", a first branch point, a first splice site 3', an intronic splicing modifier recognition element (iREMS) endogenous or non-endogenous, a second branching point and a second 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, the pre-mRNA transcript being is a pre-mRNA transcript of a gene that is not selected from ABHD1I0, ADAM12, AKT1, ANXA1l1, APLP2, APPL2, ARMCX6, ATG5, AXINlI, BAIAP2, CCNBLIIP1l, CCT7, CEP57, CSF1, DLGAP4, EPNl, ERGIC3, FOXM1, GX7, LRRC42, MADD, MANIB1l, MRPL39, PCBP4, PPHLNl, PRKACBE, RAB23, RAPIA, RCCl, SREK1, STRN3 and TNRC6A.
[00384] [00384] In another particular aspect, the invention provides a method for modifying RNA splicing in order to produce a mature mMRNA transcript containing an iExon, wherein the method comprises placing a cell or cell lysate containing a pre transcript -mRNA in contact with a compound of Formula (1) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the 5 '/ to 3' direction: a first 5 'splice site, a first branching point, a first 3' splice site, an intronic splicing modifier recognition element (iREMS ) endogenous or non-endogenous, a second branching point and a second 3 'splice site, in which iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre- mRNA is a pre-mRNA transcript of a gene that and is not selected from ABHD10, ADAM12, AKT1l, ANXA1l1, APLP2, APPL2, ARMCX6, ATG5, AXINlI, BAIAP2, CCNB1IIPl, CCT7, CEP57, CSFl1, DLGAP4, EPNl, ERGIC3, FOXMD, GX7, , LRRC42, MADD, MANIBl, MRPL39, PCBP4, PPHLNl, PRKACBE, RAB23, RAPIA, RCCl, SMN2, SREKl, STRN3 and TNRC6A.
[00385] [00385] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a nucleotide sequence of the RNA including, in the 5 to 3 "direction: a modifier recognition element endogenous or non-endogenous intronic splicing (iREMS) a branching point and a 3 'splice site, wherein iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide.
[00386] [00386] In one aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing the pre-mRNA transcript mRNA in contact with a compound of Formula (I) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element a branch point and a 3 'splice site , wherein the iREMS comprises an RNA sequence GAgurngn, where r is adenine or guanine and n is any nucleotide.
[00387] [00387] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-MRNA transcript, wherein the method comprises placing a cell or lysate from the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element a branch point and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide. In some aspects, the intron also comprises in the 5th ”to 3 'direction: a 5' splice site, a branch point and a 3 'splice site upstream of iREMS. In some respects, the pre-mRNA transcript is encoded by a gene described here (eg, in a table).
[00388] [00388] In one aspect in particular, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing the transcript of pre-mRNA in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream from the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 '”to 3" direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element a branch point and a splice 3 ', where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, the pre-mRNA transcript being a pre-mRNA transcript of a gene that is selected from ABCAlO, ABCB8, ABCC3, ACTA2, ADAL, ADAMTS1, ADC Y3, ADD1l, ADGRG6, ADH6, ADHFEl, AFF3, AGPAT4, AKAP3, ANK1l, ANK3, ANKRA2, ANKRD33B, ANKRD36, AP4B1-AS1, APIP, ARHGAP1, ARHGAP12, ARHGEF16, ARC, AR5, AR5 ATP2A3, ATXNI1, B3GALT2, B3GNT6, BCL2L15, BCYRN1, BECN1, BHMT2, BIN3-IT1, BIRC3, BIRC6, BTG2, BTN3Al, ClOorf54, Cllorf70, Cllorf94, Cl20orf4, Clorf, Clorf, Clorf C8orf44, C8orf44-SGK3, C8orf88, CAl3, CA3, CACNAZD2, CACNBI1, CADM1, CAND2, CASP7, CCDCl22, CCDC79, CCER2, CCNF, CECRT, CELSR1, CEMIP, CENPI, CEP112, CEP170, CEP170, CEP170 CLDN23, CLTA, CMAHP, CNGA4, CNRIPl, CNTDl, COLI1Al, COLI14Al, COL15A1, COL5Al, COL5A3, COL6A6, COLBS8Al, COLEC12, COMP, CPA4, CPQ, CPSF4, CRISPLD2, CRLFl, CRYBGN, CSY1, CRYBG, CSY CYGB, CYP1B1l, DAGLB, DCAF17, DCLK1, DCN, DDIT4L, DDX50, DEGS1, DEPTOR, DFNB59, DIRAS3, DLG5, DLGAP4, DNAH8, DNAJCI13, DNAJC27, DNMBP, DOCK1l1, DYNCI1, DYNCI1, DYNCI ELP4, EMX20S, ENAH, ENPPl, EP300, ERCCl , ERCC8, ERGIC3, ERLIN2, ERRFIl, ESMl, EVC, EVC2, F2R, FAIM, FAMI26A, FAMI13A, FAMI160Al, FAMI1I62A, FAMI74A, FAM20A, FAM46B, FAMG65B, FAP, FARPI1, FBLN2, FLF2, FL2 , FLTl, FRASl, FSCN2, GAL3ST4, GALNT15, GATA6, GBGT1, GCNT1, GDF6, GGACT, GLCE, GNAQ, GPR183, GPR50, GPRCS5A, GPRCSB, GRTPl, GUCAIB, GULPl, GXYLT1
[00389] [00389] In one particular aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3 "direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is selected from ABCAlO, ABCB8, ABCC3, ACTA2Z, ADAL, ADAMTS1, ADCY3, ADDI1, ADGRG6, ADH6, ADHFEl, AFF3, AGPAT4, AKAP3, ANKl, ANK3, ANKRA2, ANKRD33B, ANKRD36, AP4B1-AS1, AP16, ARHAPH, ARH, ARH ARLI15, ARL9, ARMCX6, ASICl, ATG5, ATP2A3, ATXNI1, B3GALT2, B3GNT6, BCL2L15, BCYRN1, BECN1, BHMT2, BIN3-ITl, BIRC3, BIRC6, BTG2, Cl4, Cl4, Cl4
[00390] [00390] In one particular aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is selected from ABCAl, A BCAlIO, ABCB7, ABCB8, ABCCl, ABCC3, ABHDIO, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM12, ADAM15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS19, ADCY3, ADDl, ADGR6, ADGR6 AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDC1, AHRR, AJUBA, AKO21888, AK310472, AKAPl, AKAP3, AKAP8L, AKAP9, AKNA, AKTl, ALCAM, ALDH4Al, ANPK2, ANK, ANKHDI-EIF4EBP3, ANKRA2Z, ANKRD13C, ANKRD17, ANKRD33B, ANKRD36, ANKS6, ANP32A, ANXAl1l, ANXA6, AP2Bl, AP4BI1-AS1l, APAF1, APIP, APLP2, APHAP2, APHAP2, APHAP2, ARHGEF16, ARIDIA, ARID2, ARID5B, ARL9, ARL15, ARLSB, ARMCX3, ARMCX6, ARSJ, ASAPl, ASIC1, ASL, ASNS, ASPH, ATAD2B, ATF6, ATF7IP, ATG5, ATG9A, ATIN, ATP2A3, ATP2A3, ATP2 AURKA, AXINlI, B3GALT2, B3GNT6, B4GALT2, BACEl, BAG2, BASP1, BC033281, BCAR3, BCL2L15, BCYRN1I, BECNl, BEND6, BHMT2, BICDl, BINI, BIN3, BINC, BIN3, BINC, BRCA2, BRD2, BRPF1, BSCL2, BTBD10, BTG2, BTIN3Al, BzZWl, CIQTNF9B-
[00391] [00391] In one particular aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is selected from APOA2, A SAPl, BRCAl, BRCA2Z, CDKNIC, CRX, CTRC, DENNDS5A, DIAPH3, DMD, DNAH11, EIF2B3, GALC, HPSl, HTT, IKBKAP, KIAA1I524, LMNA, MECP2, PAPD4, PAX6, PCCB, PT3, SPINK5, SREKl, TMEM67, VWF, XDH and XRN2.
[00392] [00392] In one aspect in particular, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3 "direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is selected from ABCAl, A BCAIO, ABCB7, ABCB8, ABCCl, ABCC3, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2Z, ADAL, ADAM15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS19, ADCY3, ADDl, ADGRG6, ADH6, ADH6, ADH6, ADH6, ADH6 AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDC1l, AHRR, AJUBA, AKO21888, AK310472, AKAPl, AKAP3, AKAP8L, AKAP9, AKNA, ALCAM, ALDH4Al, AMPD2, ANKl, ANK, ANK2, ANK3, ANK2, ANK3 ANKRD13C, ANKRD17, ANKRD33B, ANKRD36, ANKS6, ANP32A, ANXA6, AP2Bl, AP4BI-AS1, APAFl, APIP, APOA2, APP, APTX, ARHGAP1, ARHGAP12, ARHGAP22, ARHGAP5, ARH, ARIDS, ARHGAP5, ARH ARLSB, ARMCX3, ARSJ, ASAPl, ASICl, ASL, ASNS, ASPH, ATAD2B, ATF6, ATF7IP, ATG9A, ATMIN, ATP2A3, ATP2C1, ATXN1, ATXN3, AURKA, B3GALT2, B3GNT6, B3G3T, B3G BCAR3, BCL2L15, BCYRNl, BECNl, BEND6, BHMT2, BICD1l, BINlI, BIN3, BIN3-ITl, BIRC3, BIRC6, BNCl, BNC2, BRCAl, BRCA2, BRD2, BRPF1, BSCL2, CLBN, BTG AS1, Clorf27, Clorf86, ClO0orf54, Cllorf30, Cllorf70, Cllorf'73, Cllorf76, Cllor f94, Cl20rf4, Cl20rf56, Cl40rfl132, Cl7orf76-AS1, Cl90rf47, C2orf47, C3, C4o0orf27, CB5orf24, C6orf48, CT7orf3l, C8orf34, C8orf44, C8orf44-SGK3, C8orf88, C4C3C, AC3 CADM1l, CADM2, CALU, CAMKK1, CAND2, CAPNS1, CASC3, CASP7, CASP8SAP2, CAV1l, CCARlI, CCDCT7T7, CCDC79, CCDC88A, CCDC92, CCDCl22, CCER2, CCNF, CCNL2, CCT6A, CDB, CD27, CD27, CDCA7, CDH11, CDHI13, CDH18, CDKI11B, CDKl6, CDKAL1, CDKNIC, CECR7, CELSR1l, CEMIP,
[00393] [00393] In one particular aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is not SMN2.
[00394] [00394] In one particular aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mMRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is not selected from ABH D1I0, ADAM12, AKTl, ANXAll, APLP2, APPL2, ARMCX6, ATG5, AXIN1I, BAIAP2, CCNB1IP1, CCT7, CEP57, CSFl, DLGAP4, EPN1, ERGIC3, FOXMl, GGCT, GRAMD3, LDD, LM7 MRPL39, PCBP4, PPHLNl, PRKACB, RAB23, RAPIA, RCCl, SREK1, STRN3 and TNRCG6A.
[00395] [00395] In one particular aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, wherein the method comprises placing a cell or lysate of the cell containing the pre-mRNA transcript in contact with a compound of Formula (1) or a form thereof, wherein the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, in the 5 'to 3' direction: an endogenous or non-endogenous intronic splicing modifier (iREMS) recognition element branching site and a 3 'splice site, where iREMS comprises a sequence of RNA GAqurngn, where r is adenine or guanine and n is any nucleotide, with the pre-mRNA transcript being a pre-mRNA transcript from a gene that is not selected from ABH DIO0, ADAM12, AKTl, ANXAll, APLP2, APPL2, ARMCX6, ATG5, AXINl, BAIAP2, CCNBIIP1l, CCT7, CEP57, CSFl, DLGAP4, EPN1l, ERGIC3, FOXMl, GGCT, GRAMD3, LIBAR, MANDI, MRPL39, PCBP4, PPHLN1, PRKACB, RAB23, RAPIA, RCCl, SMN2, SREK1, STRN3 and TNRC6A.
[00396] [00396] In certain respects, the cell (s) placed in contact or cultured (s) with a compound of Formula (1) or a form thereof is / are primary cell (s) or cell (s) of a cell line. In some respects, the cell (s) placed in contact with or cultured (s) with a compound of Formula (1) or a form thereof is / are fibroblast (s), immune cell (s) ( muscle cell (s). In some embodiments, the cell (s) placed in contact with or cultured (s) with a compound of Formula (1) or a form thereof is / are a cancer cell. Non-limiting examples of cell lines include 3T3, 4T1l, 721, 9L, A2780, Al72, A20, A253, A431, A-549, ALC, Bl6, B35, BCP-1, BEAS-2B, bEnd.3, BHK, cells BR 293, BT20, BT483, BxPC3, C2Cl2, C3H-10T1 / 2, C6 / 36, C6, Cal-27, CHO, COR-L23, COS, COV-434, CML T1, CMT, CRL7030, CT26, DlI7, DH82, DUl45, DuCaP, EL4, EM2, EM3,
[00397] [00397] In certain aspects described herein, the cell (s) is / are contacted or cultured with a compound of Formula (1) or a form thereof with a compound of Formula ( I) or a form thereof for a period of 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 8 hours, 12 hours, 18 hours, 24 hours, 48 hours, 72 hours or more. In other aspects described herein, the cell (s) is / are contacted or cultured with a compound of Formula (1) or a form thereof with a compound of Formula (1) or a form for a period of 15 minutes to 1 hour, 1 to 2 hours, 2 to 4 hours, 6 to 12 hours, 12 to 18 hours, 12 to 24 hours, 28 to 24 hours, 24 to 48 hours, 48 to 72 hours.
[00398] [00398] In certain aspects described here, the cell (s) is / are placed in contact or cultured (s) with a certain concentration of a compound of Formula (TI) or its form, in which the given concentration is 0.01 µM, 0.05 µM, 1 µM, 2 µM, µM, 10 µM, 15 µM, 20 µM, 25 µM, 50 µM, 75 µM, 100 µM, or 150 µM
[00399] [00399] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene, wherein the precursor RNA transcript, transcribed from the gene, comprises a
[00400] [00400] In one aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, methods comprising administering to a human individual or not a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[00401] [00401] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, wherein the precursor RNA transcript, transcribed to from the gene, it comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (II) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (II), or a form of itself, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 "to 3 'direction: a first 5' splice site, a first branch point, a first 3 'splice site, an intronic REMS, a second branch point and a second 3 'splice site. In another specific aspect, the precursor RNA transcript contains in the 5' to 3 "direction: an intronic REMS, a branch point and a 3 'splice site.
[00402] [00402] In one particular aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts from a gene in an individual, wherein the precursor RNA transcript , transcribed from the gene, comprises an intronic REMS (for example, an endogenous intronic REMS or a non-endogenous intronic REMS), methods comprising administering to the individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent, the gene being selected from ABCAl, ABCA101, ABCB7, ABCB8, ABCC1, ABCC3, ABHD10, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM12, ADAM15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS19, ADCY3, ADDl, ADGRG6, ADH6, ADHFE1, AFF2, AFF3, AGK, AGPATY, AGP4 AHDCl, AHRR, AJUBA, AKO21888, AK310472, AKAPl, AKAP3, AKAP8SL, AKAP9, AKNA, AKT1, ALCAM, ALDH4Al, AMPD2, ANK1l, ANK2, ANK3, ANKFYl, ANKHD1-
[00403] [00403] In a specific aspect of the previous one, the precursor RNA transcript contains in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect of the previous one, the precursor RNA transcript contains in the 5 'to 3 "direction: a first 5' splice site, a first branching point, a first 3 'splice site, an intronic REMS, a second point branching and a second 3 'splice site In another specific aspect of the previous one, the precursor RNA transcript contains in the 5' to 3 'direction: an intronic REMS, a branching point and a 3' splice site.
[00404] [00404] In another specific aspect of the previous one, the gene is selected from ABCAl, ABCAlIO, ABCB7, ABCB8, ABCCI1l, ABCC3, ABHD10, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM12, ADAM15, ADAM17 , ADAM33, ADAMTS1, ADCY3, ADD1, ADGRG6, ADH6, ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDC1, AHRR, AJUBA, AKO21888, AK310472, AKAPH, AKAPL, AKAP, ALA, AKAP, ALA , AMPD2, ANK1, ANK2, ANK3, ANKFYl, ANKHD1- EIF4EBP3, ANKRA2, ANKRD17, ANKRD33B, ANKRD36, ANKS6, ANP32A, ANXAl1, ANXA6, AP2Bl, AP4B1-AS1, APX1, AP1, AP1, AP1 , ARHGAPl2, ARHGAP22, ARHGEFl6, ARIDIA, ARID2, ARIDSB, ARL9, ARLI15, ARMCX3, ARMCX6, ASAPl, ASICl, ASL, ASNS, ASPH, ATAD2B, ATF7IP, ATG5, ATG9A, ATMIN, ATP2
[00405] [00405] In another specific aspect of the previous one, the gene is selected from ABCAl, ABCB7, ABCCl, ABHD1IO, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ADAM12, ADAM15, ADAM17, ADAM33, AFF2, AGK, AGPAT3, AGPS , AHCYL2, AHDCl, AHRR, AJUBA, AK021888, AK310472, AKAPl, AKAP9, AKNA, ALCAM, ALDH4Al, AMPD2, ANK2, ANKFYl, ANKHD1I-EIF4EBP3, ANKRD17, ANKS6, ANP6, AN1, APP, , APPL2, APTX, ARHGAP22, ARIDIA, ARID2, ARMCX3, ASAPl, ASL, ASNS, ASPH, ATAD2B, ATF7IP, ATG9A, ATMIN, ATP2Cl, ATXN3, AURKA, AXINl, B4GALT2, BACEl, BAG3, BAG3, BAS3 , BICD1l, BINlI, BNC1, BRD2, BRPF1, BSCL2, BTBD10, BZW1, Cllorf30, Cllorf'73, Cl7orf76-AS1, C40rf27, C5orf24, C60rf48, C90rf69, CAB39, CALU, CAMKKl, CAPNS1, CASNS , CCDC77, CCDC88A, CCDC92, CCT6A, CD276, CD46, CDC25B, CDC40, CDC42BPA, CDCA7, CDHll, CDH13, CDKI11B, CDKl6, CDKAL1l, CEP68, CFLAR, CHD8, CIZl, CLICl, CLK4, COL1, , COL6Al, COPST7B, CPEB2, CREB5, CRLS1l,
[00406] [00406] In another specific aspect of the previous one, the gene is selected from ABCB8, ANKRD36, APLP2, ARHGAP12, ARMCX6, ASAPl, ATG5, AXINlI, BIRC6, Clorf86, CDC42BPA, CLTA, DYRKI1A, ERGIC3, FXMGL, , KAT6B, KDM6A, KIF3A, KMT2D, LARP7, LYRM1, MADD, MAN2Cl, MRPL55, MYCBP2, MYO9B, PNISR, RAPIA, RAPGEF1, SENP6, SH3YLl, SLC25Al7, SMN2, ZRE, E3F, N3, TM4, STR .
[00407] [00407] In another specific aspect of the previous one, the gene is selected from ABCB8, ANKRD36, ARHGAP12, ARMCX6, ATG5, BIRC6, Clorf86, CLTA, DYRKIA, FBXL6, KAT6B, KDM6A, KMT2D, LYRM1, MAN2C1, MR2P1, , PNISR, RAPGEFl, SENP6, SH3YLl, TMEMI134 and ZNF431.
[00408] [00408] In another specific aspect of the previous one, the gene is selected from ABCAlIO, ABCCl, ACTA2, ADAL, ADAM12, ADAMTS1, ADAMTS5, ADDl, ADGRG6, ADH6, ADHFEl, AFF2, AFF3, AGK, AGPS, AKAP3, ANK1l , ANK2, ANK3, ANKRD33B, ANXAll, ANXA6, AP4Bl- AS1, ARHGEFl6, ARID5B, ARL9, ARMCX3, ASAPl, ASICl, ATP2A3, B3GALT2, B3GNT6, BCL2L15, BCYRN1, BIRC, BT2, BIR3 , Cllorf94, Cl20rf56, Cl90rf47, C3,
[00409] [00409] In another specific aspect of the previous one, the gene is selected from ABCAlO, ACTA2, ADAL, ADAMTS1, ADAMTSS5, ADD1l, ADGRG6, ADH6, ADHFE1l, AFF3, AKAP3, ANK1l, ANK3, ANKRD33B, AP4B1-AS1, ARHGE , ARIDSB, ARL9, ASIC1l, ATP2A3, B3GALT2, B3GNT6, BCL2L15, BCYRNlI, BIN3-ITl, BIRC3, BTG2, ClO0orf54, Cllorf70, Cllorf94, Cl2o0rf56, Cl9o0rf47, C3, C3, C3, C3, C3, C3 , CAND2, CCDC79, CCER2, CCNF, CELSR1, CEMIP, CEP170, CFH, CIITA, CLDN23, CMAHP, CNGA4, CNTD1, COL11Al1, COLI4Al, COLISAl, COL5SAl, COL5A3, COL6A6, COL8Al, COLEC12, COMPQ, CP2 , CRLFl, CRYL1, CYBSR2, CYGB, CYPIBl, DCLKl, DCN, DDIT4L, DDX50, DEGS1, DEPTOR, DFNB59, DIRAS3, DLG5, DNAH8, DNAJC27, DOCKl1l, DYNC1Il, DZIPIL, ELZ, EMX, EF4, , ERCC8, ESM1, EVC2, F2R, FAMI60Al,
[00410] [00410] In another specific aspect of the previous one, the gene is selected from ABCB8, ABCC3, ADAM17, ADCY3, AGPATA4, ANKRA2, ANXAll, APIP, APLP2, ARHGAPl, ARLI5, ASAPl, ASPH, ATAD2B, ATXN1l, AXINlI, BECN , BHMT2, BICDl, BTN3Al, Cllorf30, Cllorf73, Cl2o0rf4, Cl4orfl32, C8orf44, C8orf44-SGK3, C8orf88, CASC3, CASP7, CCDCl22, CDH13, CECR7, CENPI, CEPl12, CEP, C2PS, CR2, CHEK1 , CRYBG3, CSNKI1E, CSNK1G1, DAGLB, DCAF17, DCUNID4, DDX42, DENNDIA, DENND5A, DGKA, DHFR, DIAPH3, DLGAP4, DNAJC13, DNMBP, DOCK1l, DYRKIA, EIF2B3, ERA, E1, E3 , ERRFIl, EVC, FAFl1, FAIM, FAMI26A, FAMI3A, FAMI62A, FAMI74A, FAMI98B, FBN2, FER, FHOD3, FOCAD, GALC, GCFC2, GGACT, GGCT, GLCE, GOLGAA4, GOLGB1l, GPSM2, GULT1, GULT1, , HLTF, HMGA2, HNMT, HPS1, HSD17B12, HSD1I7B4, HTT, IFT57, INPP5SK, IVD, KDM6A, KIAAIL524, KIAAl715, LETM2, LOC400927, LRRC42, LUC7L3, LYRM1, MEDI, LY , MMS19, MRPL45, MRPS28, MTERF3 , MYCBP2, MYLK, MYOF, NGF, NREP, NSUN4, NT5C2, OSMR, OXCT1, PAPDA4, PCM1, PDE7A, PDS5B, PDXDC1, PIGN, PIK3CD, PIK3R1, PIKFYVE, PITPNB, PLEKHAl, PMS, PPLE, PL , PPIPSK2, PPPIR26, PRPF3l, PRSS23, PRUNE2, PSMA4, PXK, RAFl, RAPIA, RAPGEF1, RARS2, RBKS, RERE, RFWD2, RNFT1l, RPAl, RPS10, RPS6KB2, SAMD4A, SARIA, SERY, S2, SER, , SH3YL1, SKA2, SLC12A2, SLC25Al7, SLC44A2, SMYD3, SNAP23, SNHG16, SNX7, SOS2, SPATAI8, SPATAS, SPIDR, SPRYD7, SRGAPl, SRRM1l, STAT1, STRN3, STXBP6, TF, TSF2, SU2 , TIAM1I, TJIP2, TMC3, TMEMI1I89-UBE2Vl, TMEM214, TNRC6A, TNS3, TOEl, TRAF3, TRIM65, TSPAN2, TTC7B, TUBEl, TYW5, UBAP2L, UBE2V1,
[00411] [00411] In another specific aspect of the previous, the gene is selected from ABCB8, ABCC3, ADCY3, AGPAT4, ANKRA 2, APIP, ARHGAP1l, ARL15, ATXN1l, BECNl, BHMT2, BTN3Al, Cl20orf4, Cl40rfl132, C8orf4444, C8orf44, C8orf44, C8orf4444 -SGK3, C8orf88, CASP7, CCDC122, CECR7, CENPI, CEP1112, CEP192, CHEKl, CMAHP, CNRIPl, CPSF4, CRISPLD2, CRYBG3, CSNKI1E, CSNK1G1, DAGLB, DCAFY, DNA, DLA300, DLGA , ERLIN2, ERRFIl, EVC, FAIM, FAMI2Z6A, FAMI3A, FAMI62A, FAMI74A, FBN2, GGACT, GLCE, GULP1, GXYLT1, HDX, HMGA2, HNMT, HPSl, IFT57, INPPSK, IVD, LYM1, LOC, L2M4, , MB21D2, MCM10, MED13L, MEFN2, MRPL45, MRPS28, MTERF3, MYCBP2, NGF, OXCT1l, PDS5B, PIGN, PIK3CD, PIK3R1I, PIKFYVE, PLEKHAl, PLSCRI, POMT2, PPARG, PPFP, PRIPP, PPIPK , RAPGEFl1, RARS2, RBKS, RERE, RPAl, RPS10, RPS6KB2, SAMD4A, SEC24A, SENP6, SERGEF, SGK3, SH3YL1, SKA2, SLC12A2, SLC44A2, SNX7, SPATAI8, SPATA5SD, SPIDR6, SPIDR, , TCFl2, TCF4, TIAM1I, TMC3, TMEM 189-UBE2V1, TMEM214, TNRC6A, TTC7B, TUBEl, TYW5, URGCP, VAV2, WDR27, WDR91, WNKl, ZCCHC8, ZFP82, ZNF138, ZNF232 and ZNF680.
[00412] [00412] In another specific aspect of the previous one, the gene is selected from ABHD10, ADAL, ADAM17, ADAM23, ADAMTS19, AGPAT4, AGPS, AKAP8L, AKTl, ANKRD13C, ANXAll, APIP, APPL2, ARHGAP1, ARHGAP5, ARL15, ARLSB , ARSJ, ASAP1l, ATF6, BECN1, BHMT2, BIN3, BNC2, BTBD1IO, CIQTNF9B-AS1, Clorf27, Cllorf30, Cllorf73, Cllorf76, Cl20rf4, C2orf47, CEPAC, CACNB4, CADM2, CCN2 , CEP57, CHEKl, CHRM2, CMAHP, CMSS1, CNOT7, CNRIPl, CNTNl, COPST7B, CRISPLD2, CRYBG3, CUX1, DAAM1, DCAF17, DCUNID4, DDX42, DENNDIA, DENND4A, DENND5A, DTIND, DETI1
[00413] [00413] In another specific aspect of the previous one, the gene is selected from APOA2, ASAP1, BRCAl, BRCA2, CDKNIC, CRX, CTRC, DENND5A, DIAPH3, DMD, DNAH11, EIF2B3, GALC, HPS1l, HTT, IKBKAP, KIAA1l524 , LMNA, MECP2, PAPD4, PAX6, PCCB, PITPNB, PTCEHI1, SLC34A3, SMN2, SPINK5, SREKl, TMEM67, VWF, XDH and XRN2.
[00414] [00414] In another specific aspect of the previous one, the gene is selected from ABCAl, ABCAlO, ABCB7, ABCB8, ABCCI1, ABCC3, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM15, ADAM17, ADAM23, ADAM33 , ADAMTS1, ADAMTS19, ADCY3, ADDl, ADGRG6, ADH6, ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDC1, AHRR, AJUBA, AKO21888, AK310472, AKAP9, AKAPAP , ALDH4Al, AMPD2, ANK1l, ANK2, ANK3, ANKFY1, ANKHD1-EIF4EBP3, ANKRA2, ANKRD13C, ANKRD17, ANKRD33B, ANKRD36, ANKS6, ANP32A, ANXA6, AP2, AP2, AP2, AP1, AP1, , ARHGAP12, ARHGAP22, ARHGAP5, ARHGEFl16, ARIDI1A, ARID2, ARIDSB, ARL9, ARL15, ARLSB, ARMCX3, ARSJ, ASAP1l, ASICI1, ASL, ASNS, ASPH, ATAD2B, ATF6, ATF, ATP, AT2 , ATXN3, AURKA, B3GALT2, B3GNT6, B4GALT2, BACEIl, BAG2, BASPl, BCO033281, BCAR3, BCL2L15, BCYRNlI, BECNl, BEND6, BHMT2, BICDl, BINlI, BIN3, BIN3, BIN3, BIN3, B3 , BRCA2, BRD2, BRPFl1, BSCL2, BTBD10, BTG2, BTN3Al, Bz Wl, CLIQTNF9B-AS1, Clorf27, Clorf86, ClOorf54, Cllorf30, Cllorf70, Cllorf73, Cllorf76, Cllorf94, Cl20rf4, Cl20rf56, Cl4orfl32, Cl7orf76-AS1, Cl90orf47, C2orf47, C3, C40, C40, C40, C40 C8orf44-SGK3, C8orf88, C90rf69, CA1L3, CA3, CAB39, CACNA2D2, CACNBl, CACNB4, CADM1l, CADM2, CALU, CAMKK1, CAND2, CAPNS1l, CASC3, CASP7, CASP8AP2, CAVDC, CC92, CCI CCDC122, CCER2, CCNF, CCNL2, CCT6A, CD276, CD46, CDC25B, CDC40, CDC42BPA, CDCA7, CDHI11, CDH13, CDH1I18, CDK1I1B, CDKl6, CDKALl, CDKNIC, CECR7, CEMS1, CELIPRI CEP192, CEP68, CFH, CFLAR, CHD8, CHEKl, CHRM2, CIITA, CIZl, CLDN23, CLICl, CLK4, CLTA, CMAHP, CNGA4, CNOTl, CNRIP1, CNTDl, CMSS1l1, CNOT7, CNRIP1, CNTN1, C1C1 COL12A1l, COLI14A1l, COLI15A1l, COL5SAl,
[00415] [00415] In another aspect, the gene is not SMN2.
[00416] [00416] In another aspect, the gene is not selected from ABHD10, ADAM12, AKT1, ANXAll, APLP2, APPL2, ARMCX6, ATG5, AXIN1, BAIAP2, CCNBlIPl, CCT7, CEP57, CSFl, DLGAP4, EPNl, ERGIC3, FOXM1 , GGCT, GRAMD3, HSDI7B4, LARP7, LRRC42, MADD, MANIBI1, MRPL39, PCBP4, PPHLN1, PRKACB, RAB23, RAPIA, RCCl, SREK1, STRN3 and TNRC6A.
[00417] [00417] In another aspect, the gene is not selected from ABHD10, ADAM12, AKT1, ANXAl1, APLP2, APPL2, ARMCX6, ATG5, AXINI1, BAIAP2, CCNB1IIPl, CCT7, CEP57, CSFl, DLGAP4, EPNl, ERGIC3, FOG1 , GGCT, GRAMD3, HSD1I7B4, LARP7, LRRC42, MADD, MANIBI1, MRPL39, PCBP4, PPHLN1, PRKACB, RAB23, RAPIA, RCCl, SMN2, SREK1, STRN3 and TNRC6A.
[00418] [00418] In another particular aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts from a gene in an individual, wherein the precursor RNA transcript , transcribed from the gene, comprises an intronic REMS (for example, an endogenous intronic REMS or a non-endogenous intronic REMS), methods comprising administering to the individual a compound of Formula (II) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (LI), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 "to 3 'direction: a first 5' splice site, a first branch point, a first 3 'splice site, an intronic REMS, a second branch point and a second 3 'splice site. In another specific aspect, the precursor RNA transcript contains in the 5 "to 3" direction: an intronic REMS, a branch point and a 3' splice site.
[00419] [00419] In another particular aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts from a gene in an individual, wherein the precursor RNA transcript , transcribed from the gene, comprises a non-endogenous intronic REMS, methods comprising administering to the individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form of itself, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains 5 "
[00420] [00420] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (TI), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 ”to 3 'direction: a first splice site 5', a first branch point, a first splice site 3 ', an intronic REMS, a second branch point and a second 3 "splice site. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: an intronic REMS, a branch point and a 3 'splice site.
[00421] [00421] In another aspect, the invention provides methods for modifying RNA splicing in order to modulate the amount of one, two, three or more RNA transcripts of a gene described herein, comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (LI), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. See the examples section for additional information regarding the genes described here.
[00422] [00422] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA transcript or a protein) in an individual, wherein the gene comprises a sequence of DNA nucleotides encoding two exons and an intron, where the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the DNA that encodes the intron comprises in the 5 'to 3' direction: a nucleotide sequence that encodes a first splice site 5 ', a nucleotide sequence that encodes a first branching, a nucleotide sequence that encodes a first 3 'splice site, a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a second ramie point fication and a nucleotide sequence encoding a second 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form thereof) to the individual.
[00423] [00423] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript) in an individual, wherein the gene comprises a sequence of nucleotides of DNA encoding two exons and an intron, where the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the intron DNA comprises in the 5 'to 3 "direction: a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a branch point and a nucleotide sequence that encodes a splice site 3 ', where the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, where the method it comprises administering a compound described herein (for example, a compound of Formula (1) or a form thereof) to the individual.
[00424] [00424] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript) in an individual, wherein the gene comprises a sequence of nucleotides of DNA encoding two exons and an intron, the nucleotide sequence of the DNA encoding exonic and intronic elements illustrated in Figure 1A, where the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form of it) to the individual.
[00425] [00425] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript) in an individual, wherein the gene comprises a sequence of nucleotides of DNA encoding two exons and an intron, the nucleotide sequence of the DNA encoding exonic and intronic elements illustrated in Figure 1B, where the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form of it) to the individual.
[00426] [00426] In another aspect, the invention provides a method for modifying RNA splicing in order to modulate the amount of a gene product (such as an RNA or protein transcript) in an individual, wherein the gene comprises a sequence of nucleotides of DNA encoding two exons and an intron, the DNA nucleotide sequence encoding exonic and intronic elements illustrated in Figure 1C, where the method comprises administering a compound described here (for example, a compound of Formula (1) or a form of it) to the individual.
[00427] [00427] In a specific aspect, the gene is a gene described in a table in this invention.
[00428] [00428] In certain respects, a compound of Formula (I) or its form brought into contact with or cultured with cell (s), or administered to an individual is a compound described herein.
[00429] [00429] Table 3 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value. . Table 3 ABCAl, ABCAlIO, ABCB7, ABCB8, ABCCl, ABCC3, ABHD1I0O, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ACTA2, ADAL, ADAM12, ADAMI15, ADAM17, ADAM23, ADAM33, ADAMTS1, ADAMTS1, ADAMTS19, ADAMTS19, ADCTS ADH6, ADHFEl, AFF2, AFF3, AGK, AGPAT3, AGPAT4, AGPS, AHCYL2, AHDCl, AHRR, AJUBA, AKO21888, AK310472, AKAP1l, AKAP3, AKAP8SL,
[00430] [00430] Table 4 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value. Table 4 À ABCAl, ABCB7, ABCCl, ABHD1I0O, ABL2, ABLIM3, ACACA, ACADVL, ACAT2, ADAM12, ADAM15, ADAM17, ADAM33, AFF2, AGK, AGPAT3, AGPS, AHCYL2, AHDCl, AHRR, AJUBA, AK2, AK2 AKAP1, AKAP9, AKNA, ALCAM, ALDH4Al, AMPD2, ANK2, ANKFYl, ANKHD1- EIF4EBP3, ANKRD17, ANKS6, ANP32A, ANXAl1, ANXA6, AP2B1l, APAF1, APLP2, APP, APPLID, ARX3, ASAP1, ASL, ASNS, ASPH, ATAD2B, ATF7IP, ATG9A, ATMIN, ATP2C1, ATXN3, AURKA, AXIN1l, B4GALT2, BACEl, BAG2, BASP1, BCO033281, BCAR3, BEND6, BICDl, BINI, BR2 BTBD1O, BzZWl, Cllorf30, Cllorf73, Cl7orf / 6-ASl, C40rf27, CBb5orf24, C60rf48, C90rf69o, CAB39, CALU, CAMKK1, CAPNS1, CASC3, CASP8AP2, CAV1, CCARI, CCDC6, CCDCA, CCDC6, CCDCA CDC25B, CDC40, CDC42BPA, CDCA7, CDHl1, CDH13, CDK11BE, CDK16, CDKAL1, CEP68, CFLAR, CHD8, CIZ1, CLIC1, CLK4, CNOT1, COG1, COLI2Al, COLIAl, COL6Al, COPST7B, CRP, CRP1 CSDEl, CSNKIAl, CTDSP2, CTNND1l, CUL2, CUL4A, CUX1, CYB5B, CYBRDl, CYP51Al , DAB2, DACTl, DARS, DAXX, DCAFI1O, DCAF11, DCBLD2, DCUNID4, DDAH1, DDAH2, DDHD2, DDR1, DDX39B,
[00431] [00431] Table 5 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in RNA with elements of
[00432] [00432] Table 6 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value. Table 6 | ABCCl, ACADVL, ADAM15, AGPAT3, AHRR, AJUBA, AKAPl, AKAP9, ALCAM, ALDH4Al, ANKFYl, AP2Bl, APLP2, APP, ARIDIA, ARID2, ASPH, ATMIN, BASP1, BC033281, BCAR3, Cllorf73, Cl7 C60rf48, CAB39, CASP8AP2, CAV1, CCAR1I, CCT6A, CD276, CD46, CDC25B, CDKl6, CEP68, CHD8, CLIC1, COL1I2Al, CPEB2, CREB5, CRLSl1, CRTAP, CTNNDl, CUXl, DFI, DY, DDX39B, DIAPH3, DKK3, DLCl, DSTN, EBFl, EGR1, EIF4G1, EIF4G3, ENG, ERCl, ETV5, FAMI98B, FAM219A, FAM3C, FEZ1, FGD5-AS1, FLII, FNl, FNBPl, FOS, FOS, FOX, FOX1 FYN, GABPBl, GALC, GALNT1, GBA2, GGCT, GHDC, GMIP, GNAI3, GNAS, GNL3L, GOLGA2, GORASP1, GREM1, GSEl, HAUS6, HDAC7, HEG1, HLA-A, HLA-E, HMGAl, HPIBP3, ILST, ITGAV, KIAALI549, KIFI1A4, KLCl, KLF6, KLHL7, KRT18, LAMA 2, LAMB1, LARP7, LATS2, LGALS8, LIMS1, LINCOO341, LONPl, LOX, MDM2, MEPCE, MINPPL, MSLL, MP6, MLLTA, MPPE, MSL3, MTMR9, MTRR, MUM1I, MYADM, MYLK, NADK, NAV2, NCSTN, NFE2L1, NID1l, NIPAl, NPEPPS, NRDI1l, NUDT4, NUSAP1I, P4HB, PABPCl, PAK4 , PAPD4, PCNXL2, PDE4A, PDXDCl, PHRFl, PHTF2, PI4K2A, PIK3C2B, PLAU, PLEKHB2, PLSCR3, PLXNB2, POSTN, POU2Fl1, PPARA, PPPIR1I2A, PRKACB, R3, PSMD6, PSMD6 , RBCK1, RBFOX2, RFTN1, RNF19A, RNF38, RPS6KCl, RWDD4, SEC1I4L1, SEC24B, SERPINE2, SF1l, SLC39A3, SLC41Al, SLC4A4, SLC7A6, SMARCA4, SMN2, SNH, STR, SNH2 , TBL2, TGFBI, TGFBR1, THAP4, TLE3, TMEM47, TNKSIBPl1, TOMM40, TOPORS, TRAK1,
[00433] [00433] Table 7 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value.
[00434] [00434] Table 8 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value.
[00435] [00435] Table 9 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value.
[00436] [00436] Table 10 shows genes that demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with an intronic REMS sequence in cells treated with Compound 64 (24 nm and 100 nm),
[00437] [00437] Table 11 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value. .
[00438] [00438] Table 12 shows certain genes that are expected to demonstrate an effect on the inclusion of an iExon or the formation of an eExon with a corresponding variation in the abundance of isoforms, as a result of the generation of iExon or eExon in the RNA with REMS elements intronic in the presence of a compound as described herein. The variation in abundance is expected to have a statistically significant p-value. .
[00439] [00439] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease associated with the abnormal expression of a gene product (e.g., an mRNA or protein transcript), wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3 "direction: a 5' splice site, a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the transcript of the The precursor RNA comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5' to 3 'direction: a first splice 5 ', a first branching point, a first splice site 3', an intronic REMS, a second branching point and a second splice site 3 '. In another specific aspect, the precursor RNA transcript contains in the 5' direction for 3 ': an intronic REMS, a branch point and a 3' splice site.
[00440] [00440] In certain aspects, the gene is any of the genes described here. In some respects, the gene contains a nucleotide sequence that encodes a non-endogenous intronic REMS. In one aspect, the invention provides methods for modifying RNA splicing to prevent and / or treat a disease associated with the abnormal expression of a gene product (e.g., an mRNA, RNA or protein transcript) described herein. , methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a vehicle, excipient or pharmaceutically acceptable diluent.
[00441] [00441] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease associated with the abnormal expression of a gene product described herein (e.g., an mRNA, RNA transcript) or protein), wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (1) or a form thereof, or a composition pharmaceutical product comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a branch point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a first 5 'splice site, a first branch point, a first 3' splice site, an intronic REMS, a second branch point and a second 3 "splice site. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: an intronic REMS, a branch point and a 3 'splice site.
[00442] [00442] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease associated with the abnormal expression of a gene product (eg, an mRNA, RNA or protein transcript) ) described herein, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a composition pharmaceutical product comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a 5 'splice site, a branching point, a 3' splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a first 5 'splice site, a first branch point, a first 3' splice site, an intronic REMS, a second branch point and a second 3 "splice site. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: an intronic REMS, a branch point and a 3 'splice site.
[00443] [00443] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease associated with the abnormal expression of a gene product described herein (e.g., an mRNA, RNA transcript) or protein), comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a vehicle, excipient or pharmaceutically acceptable diluent. See the examples section for additional information regarding the genes described here.
[00444] [00444] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which a variation in the level of expression of one, two, three or more RNA isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3 "direction: a 5' splice site, a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the transcript of the The precursor RNA comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5' to 3 'direction: a first splice 5 ", a first branching point, a first splice site 3 ', an intronic REMS, a second branching point and a second splice site 3". In another specific aspect, the precursor RNA transcript contains in the 5' direction for 3 ': an intronic REMS, a branch point and a 3' splice site.
[00445] [00445] In certain aspects, the gene is any of the genes described here. In certain aspects, the gene contains a nucleotide sequence that encodes the non-endogenous intronic REMS. In one aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which modulation (eg, increase or decrease) in the expression of one, two, three or more isoforms of RNA encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (IT), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[00446] [00446] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which the modulation (eg, increase or decrease) in the expression of one, two, three or more isoforms of RNA encoded by a gene described herein are beneficial for the prevention and / or treatment of the disease, in which the transcript of the precursor RNA, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human individual or non-human a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (II), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a 5 'splice site, a branching point, a 3' splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a first 5 'splice site, a first branch point, a first 3' splice site, an intronic REMS, a second branch point and a second 3 "splice site. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: an intronic REMS, a branch point and a 3 'splice site.
[00447] [00447] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which the modulation (e.g., increase or decrease) in the expression of one, two, three or more isoforms of RNA encoded by a gene described herein are beneficial for the prevention and / or treatment of the disease, in which the transcript of the precursor RNA, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human individual or non-human a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a 5 'splice site, a branching point, a 3' splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: a first 5 'splice site, a first branch point, a first 3' splice site, an intronic REMS, a second branch point and a second 3 "splice site. In another specific aspect, the precursor RNA transcript contains in the 5 'to 3' direction: an intronic REMS, a branch point and a 3 'splice site.
[00448] [00448] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or further RNA isoforms encoded by a gene described herein are beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a composition pharmaceutical product comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, one, two, three or more RNA isoforms encoded by a gene described herein are decreased after administration of a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent . See the examples section for additional information regarding the genes described here.
[00449] [00449] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which a variation in the level of expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human or non-human individual a compound of Formula (IL) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3 "direction: a 5' splice site, a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the transcript of the The precursor RNA comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5' to 3 'direction: a first splice 5 ', a first branching point, a first splice site 3', an intronic REMS, a second branching point and a second splice site 3 '. In another specific aspect, the precursor RNA transcript comprises in the 5' direction for 3 ": an intronic REMS, a branch point and a 3 'splice site.
[00450] [00450] In certain respects, the gene is any of the genes described here. In some respects, the gene contains a nucleotide sequence that encodes a non-endogenous intronic REMS. In one aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which modulation (eg, increase or decrease) in the expression of one, two, three or more isoforms of protein encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent.
[00451] [00451] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which the modulation (eg, increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human individual or non-human a compound of Formula (1) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a 5 'splice site, a branching point, a 3' splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: a first 5 'splice site, a first branch point, a first 3' splice site, an intronic REMS, a second branch point and a second 3 "splice site. In another specific aspect, the precursor RNA transcript comprises in the 5" to 3 'direction: an intronic REMS, a branch point and a 3' splice site.
[00452] [00452] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or more protein isoforms encoded by a gene described herein is beneficial for the prevention and / or treatment of the disease, wherein the precursor RNA transcript, transcribed from the gene, comprises an intronic REMS, methods comprising administering to a human individual or non-human a compound of Formula (I) or a form thereof, or a pharmaceutical composition comprising a compound of Formula (1), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, the precursor RNA transcript comprises in the 5 'to 3 "direction: a 5' splice site, a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the transcript of the The precursor RNA comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. In another specific aspect, the precursor RNA transcript comprises in the 5' to 3 'direction: a first splice 5 ', a first branching point, a first splice site 3', an intronic REMS, a second branching point and a second splice site 3 ". In another specific aspect, the precursor RNA transcript comprises in the 5 'to 3' direction: an intronic REMS, a branching point and a 3 'splice site.
[00453] [00453] In another aspect, the invention provides methods for modifying RNA splicing in order to prevent and / or treat a disease in which modulation (e.g., increase or decrease) in the expression of one, two, three or further isoforms of protein encoded by a gene described herein are beneficial for the prevention and / or treatment of the disease, methods comprising administering to a human or non-human individual a compound of Formula (I) or a form thereof, or a composition pharmaceutical product comprising a compound of Formula (I), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific aspect, one, two, three or more RNA isoforms encoded by a gene described herein are decreased after administration of a compound of Formula (TI), or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent . See the examples section for additional information regarding the genes described here.
[00454] [00454] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent, treat or prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in expression one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, in which the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the DNA that the intron encodes in the 5 'to 3' direction: a nucleotide sequence that encodes a first 5 'splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes there is a first splice site 3 ', a nucleotide sequence encoding an iREMS, a nucleotide sequence encoding a second branch point and a nucleotide sequence encoding a second splice site 3', in which the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form thereof) to the individual.
[00455] [00455] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent, treat or prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in expression one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, in which the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, where the nucleotide sequence of the DNA of the The intron comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a branch point and a nucleotide sequence that encodes a splice site 3 ', in which the sequence The nucleotide ratio encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide, wherein the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form of the same) to the individual.
[00456] [00456] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent, treat or prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in expression one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, with the The nucleotide sequence of the DNA encodes exonic and intronic elements illustrated in Figure 1A, wherein the method comprises administering a compound described herein (for example, a compound of Formula (1) or a form thereof) to the individual.
[00457] [00457] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent, treat or prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in expression one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, with the The nucleotide sequence of the DNA encodes exonic and intronic elements illustrated in Figure 1B, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form thereof) to the individual.
[00458] [00458] In another aspect, the invention provides a method for modifying RNA splicing in order to prevent, treat or prevent and treat a disease in an individual, in which the modulation (e.g., increase or decrease) in expression of one, two, three or more protein isoforms encoded by a gene is beneficial for the prevention and / or treatment of the disease, in which the gene comprises a sequence of DNA nucleotides that encodes two exons and an intron, the sequence being DNA nucleotides encode exonic and intronic elements illustrated in Figure 1C, wherein the method comprises administering a compound described herein (for example, a compound of Formula (I) or a form thereof) to the individual.
[00459] [00459] In a specific aspect, the gene is a gene described in a table in this invention.
[00460] [00460] In some respects, the compound of Formula (LI) or its form that is administered to an individual is a compound described herein.
[00461] [00461] In a specific aspect, the methods described here to modify the RNA splicing, in order to prevent a disease, prevent the onset or development of one or more symptoms of the disease. In another aspect, the methods for preventing a disease described herein prevent disease recurrence or delay disease recurrence. In another aspect, the methods for treating a disease described herein exhibit one, two or more of the effects: (1) reduce or improve the severity of the disease; (ii) inhibit the progression of the disease; (iii) reduce an individual's hospitalization; (iv) reduce an individual's hospitalization period; (v) increase an individual's survival; (vi) improve an individual's quality of life; (vii) reduce the number of symptoms associated with the disease; (viii) reduce or improve the severity of a symptom (s) associated with the disease; (ix) reduce the duration of a symptom (s) associated with the disease; (x) prevent the recurrence of a symptom associated with the disease; (xi) inhibit the development or onset of a disease symptom; and / or (xii) inhibit the progression of a symptom associated with the disease.
[00462] [00462] Furthermore, the invention provides artificial gene constructs comprising a DNA sequence encoding exons and one or more introns, wherein the nucleotide sequence encoding at least one intron comprises in the 5 'to 3' direction: a sequence of nucleotides encoding a branching point, a nucleotide sequence encoding a 3 'splice site and a nucleotide sequence encoding an intronic REMS, and artificial gene constructs comprising an RNA sequence comprising exons and one or more introns, in that at least one intron comprises in the 5 'to 3' direction: a branching point, a 3 'splice site and an intronic REMS. The DNA sequence described herein can be or be derived from, for example, a genomic DNA sequence or a DNA analog thereof. The RNA sequence described herein can be or be derived from, for example, a precursor RNA transcript or an RNA analogue thereof. In this specification, the term "artificial gene construct" refers to a DNA or RNA gene construct that comprises a nucleotide sequence not found in nature.
[00463] [00463] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence comprising two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which the The nucleotide sequence of the intron RNA comprises in the 5 'to 3' direction: a first 5 'splice site, a first branching site, a first 3' splice site, an iREMS, a second branching site and a second site 3 'splice, in which the iREMS comprises a sequence of GAgurngn RNA, where r is adenine or guanine and n is any nucleotide.
[00464] [00464] In another aspect, an artificial gene construct is provided which comprises an RNA sequence comprising two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which the sequence of intron RNA nucleotides comprises in the 5 'to 3 "direction: an iREMS, a branching point and a 3' splice site, in which the iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and n is any nucleotide.
[00465] [00465] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence comprising two exons and an intron, in which the RNA sequence comprises exonic and intronic elements illustrated in Figure 1A.
[00466] [00466] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence comprising two exons and an intron, in which the RNA sequence comprises exonic and intronic elements illustrated in Figure 1B.
[00467] [00467] In another aspect, the invention provides an artificial gene construct comprising an RNA sequence comprising two exons and an intron, in which the RNA sequence comprises exonic and intronic elements illustrated in Figure 1C.
[00468] [00468] In another aspect, the invention provides an artificial gene construct comprising a DNA sequence encoding two exons and an intron, wherein the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, wherein the nucleotide sequence encoding the intron comprises in the 5 'to 3' direction: a nucleotide sequence encoding a first site splice 5 ", a nucleotide sequence encoding a first branch point, a nucleotide sequence encoding a first 3 'splice site, an iREMS, a nucleotide sequence encoding a second branch point and a nucleotide sequence which encodes a second 3 'splice site, where the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is ad enin or guanine and n is any nucleotide.
[00469] [00469] In another aspect, an artificial gene construct is provided which comprises a DNA sequence encoding two exons and an intron, wherein the nucleotide sequence encoding a first exon is upstream of the nucleotide sequence encoding the intron and the nucleotide sequence that encodes a second exon is downstream of the nucleotide sequence that encodes the intron, wherein the nucleotide sequence that encodes the intron comprises in the 5 'to 3' direction: a nucleotide sequence that encodes an iREMS, a nucleotide sequence encoding a branch point and a nucleotide sequence encoding a 3 'splice site, wherein the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide.
[00470] [00470] In another aspect, an artificial gene construct is provided that comprises a DNA sequence that encodes two exons and an intron, in which the DNA sequence encodes exonic and intronic elements illustrated in Figure 1A.
[00471] [00471] In another aspect, an artificial gene construct is provided that comprises a DNA sequence that encodes two exons and an intron, in which the DNA sequence encodes exonic and intronic elements illustrated in Figure 1B.
[00472] [00472] In another aspect, an artificial gene construct is provided comprising a DNA sequence that encodes two exons and an intron, in which the DNA sequence encodes exonic and intronic elements illustrated in Figure 1C.
[00473] [00473] In one aspect, the invention provides artificial gene constructs that comprise an intronic REMS. In one aspect, an artificial gene construct comprises genomic DNA or DNA encoding exons and one, two or more introns, in which a nucleotide sequence encoding an intronic REMS, which can be upstream or downstream of a nucleotide sequence which encodes a branching point and a nucleotide sequence that encodes a 3 'splice site, is introduced into the nucleotide sequence that encodes an intron by genetic engineering. In another aspect, an artificial gene construct comprises DNA encoding exons and one, two or more introns, wherein the nucleotide sequence encoding an intron comprises a nucleotide sequence encoding an intronic REMS, a sequence of nucleotides encoding site (s ) of splice 3 'and the nucleotide sequence encoding branch point (s), wherein the nucleotide sequence encoding an intronic REMS, which can be upstream or downstream of at least one nucleotide sequence encoding an branching point and at least one nucleotide sequence encoding a 3 'splice site, is introduced into the nucleotide sequence encoding the intron by genetic engineering. In another aspect, an artificial gene construct comprises exon-encoding DNA and one, two or more introns, in which the nucleotide sequence encoding an intron comprises a nucleotide sequence encoding site (s)
[00474] [00474] In certain respects, an artificial gene construct is produced as follows: a nucleotide sequence that encodes an intronic REMS is introduced into a nucleotide sequence that encodes an intronic branch point and an intronic 3 'splice site in the DNA genomics or DNA, where p DNA encodes two or more exons and one or more introns, the nucleotide sequence encoding the intronic REMS upstream of a nucleotide sequence encoding a branch point and a splice site 3 '. In some ways, an artificial gene construct is produced as follows: a nucleotide sequence that encodes an intronic REMS is introduced upstream of a nucleotide sequence that encodes a branch point and a splice site 3 'of genomic DNA or DNA, where the DNA encodes two or more exons and an intron (s). In a specific aspect, the nucleotide sequence encoding the intronic REMS is introduced internally within a nucleotide sequence that encodes an intron. In certain respects, an artificial gene construct is produced as follows: a nucleotide sequence that encodes an intronic REMS, a nucleotide sequence that encodes a branch point and a nucleotide sequence that encodes a 3 'splice site is introduced into a cDNA, wherein the nucleotide sequence encoding the intronic REMS can be upstream of the branching point and the 3 'splice site, respectively; or it can be downstream of the splice site 3 'and the branching point, respectively.
[00475] [00475] In certain respects, an artificial gene construct comprises an RNA sequence comprising exons and one, two or more introns, in which an intronic REMS 5 'splice site, which is downstream of a 3' splice site, is introduced into an intron by genetic engineering. In another aspect, an artificial gene construct comprises an RNA sequence comprising exons and one, two or more introns, wherein an intron comprises a 5 'splice site (s), 3' splice site (s) and point (s) ) branching (s), in which an intronic REMS, which is upstream of a 3 'splice site, is introduced into an intron by genetic engineering. In another aspect, an artificial gene construct comprises an RNA sequence comprising exons and one, two or more introns, in which an intron comprises 3 'splice site (s) and branching point (s), in which an intron is modified to introduce an intronic REMS. In specific aspects, intronic REMS is not endogenous, that is, it is not found naturally in the RNA sequence of artificial gene construction. In some respects, the artificial gene construct comprises other elements, such as a promoter (eg, a tissue-specific promoter or a constitutively expressed promoter), 5 '/ untranslated region, 3' untranslated region, site (s) binding protein (s) that binds to RNA and regulates the recognition and catalysis of splice sites (5 'and 3 "), small RNA-sensing molecule (s) , e.g., riboswitches,
[00476] [00476] In certain respects, an artificial gene construct is produced as follows: an intronic REMS is introduced into an existing 5 'splice site of the precursor RNA, in which the RNA comprises two or more exons and one or more introns, with an intronic REMS is upstream of a branch point sequence and a 3 "splice site sequence. In some respects, an artificial gene construct is produced as follows: an intronic REMS is introduced upstream of a 3 'splice site of a precursor RNA, in which the RNA comprises two or more exons and intron (s). In a specific aspect, the intronic REMS is introduced internally within an intron. In certain aspects, an artificial gene construct is produced as follows: a branch point, a 3 'splice site and an intronic REMS are introduced into an mRNA, where REMS can be downstream or upstream of the branch point and 3' splice site. The intronic REMS functions as a site 5 "splice. In some ways, the intronic REMS is located in an intron. In some respects, care must be taken when introducing an intronic REMS into an RNA sequence so as not to affect an open reading phase or introduce a stop codon. The introduction of an intronic REMS into an RNA transcript may or may not result in a protein-level amino acid exchange. In some respects, the introduction of an intronic REMS into an RNA transcript results in a protein-level amino acid exchange. In some ways, this amino acid exchange is a conservative amino acid substitution. In other respects, the introduction of an intronic REMS into an RNA transcript does not result in a protein-level amino acid exchange. Techniques known to those skilled in the subject can be used to introduce an intronic REMS and other elements, such as a branch point or a splice site 3 'into an RNA transcript.
[00477] [00477] In some respects, an artificial gene construct is present in a viral vector (eg, an adeno-associated virus (AAV), a self-complementing adeno-associated virus (SCAAV), adenovirus, retrovirus, lentivirus (eg, simian immunodeficiency, human immunodeficiency virus or modified human immunodeficiency virus), Newcastle disease virus (NDV), herpes virus (eg, herpes simplex virus), alphavirus, Vaccinia virus, etc.), a plasmid or another vector
[00478] [00478] In some ways, the artificial gene construct is an RNA molecule modified to allow cellular absorption. In some respects, the artificial gene construct is an RNA molecule containing pseudouridine or other modified / artificial nucleotides to enhance cellular absorption and gene expression.
[00479] [00479] The use of an artificial gene construct described here in gene therapy allows to regulate the amount and type of a protein produced from the construction, depending on the presence of a compound described here. The compound is essentially an adjustable switch that, depending on "the amount and duration of the compound dose, regulates the amount and type of protein produced.
[00480] [00480] In certain respects, an RNA transcript, transcribed from an artificial gene construct that is DNA, would not produce or produce substantially less functional protein in the presence of a compound described here than the amount of functional protein produced in the absence of a compound described herein. For example, if the artificial gene construct comprises a nucleotide sequence that encodes an intronic REMS, which is downstream of an intronic nucleotide sequence that encodes a 3 'splice site, then the creation of an intronic exon would ultimately result , in a smaller amount of the original protein (that is, the protein produced when the RNA splicing is not modified) that is being produced in the presence of a compound described here. Alternatively, in some ways, an RNA transcript,
[00481] [00481] In certain aspects, an artificial gene construct or vector comprising an artificial gene construct is used in cell culture. For example, in a cell (s) transfected (s) with an artificial gene construct or transduced (s) with a vector comprising an artificial gene construct, the amount and type of a protein produced from the artificial gene construct can be modulated or modified depending on whether or not a compound described here is brought into contact with the transfected cell (s). For example, if the artificial gene construct comprises a nucleotide sequence encoding an intronic REMS, which is downstream of a nucleotide sequence encoding a 3 'splice site, then the probability of producing an intronic exon would be less in the absence of the compound in relation to the presence of the compound, so the use of an artificial gene construct described here allows to regulate the amount and type of a protein produced from the construct, depending on whether a compound or compound described herein is present or not. m switch that regulates the amount and type of protein produced. Such regulation of protein production could be useful, e.g. when trying to assess the role of certain genes or the effects of certain genes on pathways. The amount of the protein produced can be modified based on the amount of a compound described here that is put in contact with the transfected cell and / or for how long the compound is in contact with the transfected cell.
[00482] [00482] In certain respects, an animal (eg, a non-human animal, such as a mouse, rat, fly, etc.) is modified by genetic engineering to contain an artificial gene construct or a vector comprising a gene construct artificial. Techniques known to those skilled in the subject can be used for genetic engineering of these animals. The amount of protein produced by that modified animal can be regulated by whether a compound described herein is administered to the animal or not. The amount of the protein produced can be titrated based on the dose and / or the duration of administration of a compound described herein to the modified animal. In some respects, the artificial gene construct encodes a detectable reporter gene, such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein, beta galactosidase, Renilla luciferase, firefly luciferase, etc. According to this aspect, the modified animal can be used to monitor development at different stages, visualize tissue function, etc. In other respects, the artificial gene construct encodes a therapeutic gene product, as described herein. According to this aspect, the modified animal can be used to monitor development at different stages or in studies of functional biology where a particular protein or isoform of the protein needs to be expressed only for a period of time and not constitutively, etc.
[00483] [00483] In certain aspects, an artificial gene construct or a vector comprising an artificial gene construct is used in gene therapy. Non-limiting examples of vectors include, but are not limited to, plasmids and viral vectors, such as vectors derived from retroviruses, adenoviruses, adeno-associated viruses and baculoviruses with defective replication. The vector can be a DNA vector or, preferably, a DNA vector. Gene therapy
[00484] [00484] In another aspect, artificial gene constructs or vectors that comprise an artificial gene construct can be used in gene therapy. The use of an artificial gene construct described here in gene therapy allows to regulate the quantity and type of a protein produced from the construction, depending on whether a compound described here is present or not. The compound is essentially a switch that regulates the amount and type of protein produced.
[00485] [00485] In certain respects provided, an RNA transcript, transcribed from an artificial gene construct which is DNA, would produce substantially more functional protein in the presence of a compound described herein than the amount of functional protein produced in the absence of a compound described here. For example, an artificial gene construct or vector that comprises a nucleotide sequence that encodes an intronic REMS, which is downstream of a nucleotide sequence that encodes a branch point and a 3 'splice site, is less likely to produce an intronic exon in the absence of a compound described herein. If the protein produced as a result of including iExon is a functional protein, then the result of administering the compound would, in the end, be
[00486] [00486] Alternatively, in certain respects, an RNA transcript, transcribed from an artificial gene construct that is DNA, would produce substantially less functional protein in the presence of a compound described here than the amount of functional protein produced in the absence of a compound described herein. For example, an artificial gene construct or vector, comprising a nucleotide sequence encoding an intronic REMS, is more likely to produce an intronic exon in the presence of a compound described herein. If the protein produced as a result of the inclusion of iExon is not a functional protein, but if the protein produced without the inclusion of iExon is a functional protein, then the result of administering the compound would be a reduction in the production of a functional protein. However, in the absence of a compound described here, normal splicing would occur, and the production of the functional protein would not be reduced. The amount and type of protein produced can be titrated based on the dose and duration of administration of the compound. In a specific aspect, the artificial gene construct used in gene therapy comprises an RNA sequence including two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, in which the sequence of The intron RNA nucleotides comprise in the 5 'to 3' direction: a first 5 'splice site, a first branching site, a first 3' splice site, an iREMS, a second branch site and a second splice site 3 ', in which the iREMS comprises a sequence of GAgurngn RNA, where r is adenine or guanine and n is any nucleotide.
[00487] [00487] In another specific aspect, the artificial gene construct used in gene therapy comprises an RNA sequence including two exons and an intron, in which a first exon is upstream of the intron and a second exon is downstream of the intron, in which the intron RNA nucleotide sequence comprises in the 5 "to 3 'direction: an iREMS, a branch point and a 3' splice site, where iREMS comprises a GAgurngn RNA sequence, where r is adenine or guanine and any nucleotide.
[00488] [00488] In another specific aspect, the artificial gene construct used in gene therapy comprises an RNA sequence including two exons and an intron, in which the RNA sequence comprises exonic and intronic elements illustrated in Figure 1A.
[00489] [00489] In another specific aspect, the artificial gene construct used in gene therapy comprises an RNA sequence including two exons and an intron, in which the RNA sequence comprises exonic and intronic elements illustrated in Figure 1B.
[00490] [00490] In another specific aspect, the artificial gene construct used in gene therapy comprises an RNA sequence including two exons and an intron, in which the sequence of
[00491] [00491] In another specific aspect, the artificial gene construct used in gene therapy comprises a DNA sequence that encodes two exons and an intron, in which the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, where the nucleotide sequence encoding the intron comprises in the 5 'to 3' direction: a nucleotide sequence encoding a first 5 'splice site, a nucleotide sequence that encodes a first branch point, a nucleotide sequence that encodes a first 3' splice site, a nucleotide sequence that encodes an iREMS, a nucleotide sequence that encodes a second point branching sequence and a nucleotide sequence encoding a second 3 'splice site, where the nucleotide sequence encoding iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine and n is any nucleotide.
[00492] [00492] In another specific aspect, the artificial gene construct used in gene therapy comprises a DNA sequence that encodes two exons and an intron, in which the nucleotide sequence that encodes a first exon is upstream of the nucleotide sequence that encodes the intron and the nucleotide sequence encoding a second exon is downstream of the nucleotide sequence encoding the intron, where the nucleotide sequence encoding the intron comprises in the 5 'to 3' direction: a nucleotide sequence encoding an iREMS , a nucleotide sequence that encodes a branch point and a nucleotide sequence that encodes a 3 'splice site, wherein the nucleotide sequence that encodes iREMS comprises a DNA sequence GAgtrngn, where r is adenine or guanine en is any nucleotide.
[00493] [00493] In another specific aspect, the artificial gene construct used in gene therapy comprises a DNA sequence that encodes two exons and an intron, in which the DNA sequence encodes exonic and intronic elements illustrated in Figure 1A.
[00494] [00494] In another specific aspect, the artificial gene construct used in gene therapy comprises a DNA sequence that encodes two exons and an intron, in which the DNA sequence encodes exonic and intronic elements illustrated in Figure 1B.
[00495] [00495] In another specific aspect, the artificial gene construct used in gene therapy comprises a DNA sequence that encodes two exons and an intron, in which the DNA sequence encodes exonic and intronic elements illustrated in Figure 1C.
[00496] [00496] An artificial gene construct, a vector comprising the artificial gene construct or an RNA molecule comprising an artificial gene construct modified to allow cellular absorption can be introduced into cells or administered directly to patients. In one aspect, an artificial gene construct or a vector comprising the artificial gene construct is introduced into cells either ex vivo or in vivo. In a specific aspect, an artificial gene construct or vector is introduced into an ex vivo cell (s) and the
[00497] [00497] In another aspect, the invention provides a method for modifying an endogenous gene so that the resulting gene contains a nucleotide sequence that encodes an intronic REMS, or contains an additional nucleotide sequence that encodes an intronic REMS (in other words, an Intronic REMS not found naturally in the endogenous gene, that is, a non-endogenous intronic REMS). In a specific aspect, the invention provides methods for modifying an endogenous gene so that the resulting gene contains a nucleotide sequence that encodes an intronic REMS and contains a nucleotide sequence that encodes a branch point and a nucleotide sequence that encodes a splice site 3 '”upstream of the nucleotide sequence encoding the intronic REMS.
[00498] [00498] In this specification, the term "endogenous gene" refers to a gene found naturally in a cell or living being. Techniques known to the person skilled in the art can be used to introduce any, two or all of the following: a branching point, a 3 'splice site and an intronic REMS into an endogenous gene, p. eg, the CRISPR-Cas approach, TALEN or ZEN can be used. In certain respects, a nucleotide sequence encoding an existing 5 'splice site can be replaced by an intronic REMS or an intronic REMS can be inserted internally within an intron. In some respects, care must be taken when introducing a nucleotide sequence that encodes an intronic REMS into an endogenous gene so that it does not affect an open reading phase or introduces a stop codon. The introduction of a nucleotide sequence that encodes an intronic REMS in an endogenous gene may or may not result in a protein-level amino acid exchange. In some respects, the introduction of a nucleotide sequence that encodes an intronic REMS into an endogenous gene results in a protein-level amino acid exchange. In some ways, this amino acid exchange is a conservative amino acid substitution. In other respects, the introduction of a nucleotide sequence that encodes an intronic REMS into an endogenous gene does not result in a protein-level amino acid exchange.
[00499] [00499] In one aspect, the invention provides kits that comprise, in a container, an artificial gene construct or a vector that comprises an artificial construct. In certain respects, the kits further comprise a compound described herein, in a separate container, and / or a negative control, such as saline with phosphate buffer or a compound that does not recognize an intronic REMS, in a separate container. In a specific aspect, the kits further comprise a positive control, as a compound described herein as a positive control. In some respects, the kits further comprise primers and / or antibodies, in one or more separate containers, to assess the production of an mRNA transcript from an artificial gene construct and / or the resulting protein production.
[00500] [00500] In another aspect, the invention provides kits comprising, in one or more containers, the components and / or reagents necessary to produce an artificial gene construct and / or a vector comprising an artificial gene construct. In another aspect, the invention provides kits comprising, in one or more containers, the components and / or reagents necessary to modify an endogenous gene so that it contains a nucleotide sequence that encodes an intronic REMS or an additional nucleotide sequence that encodes an intronic REMS (in other words, a REMS not found naturally in the endogenous gene, that is, a non-endogenous REMS). In another aspect, the invention provides kits comprising, in one or more containers, the components and / or reagents necessary to modify an endogenous gene so that the resulting gene contains a nucleotide sequence that encodes an intronic REMS and contains a nucleotide sequence which encodes a branching point and a nucleotide sequence that encodes a splice site 3 'upstream of the nucleotide sequence that encodes the intronic REMS. In some respects, the kits further comprise primers and / or antibodies, in one or more separate containers, to assess the production of an mRNA transcript from a modified endogenous gene and / or the resulting protein production.
[00501] [00501] In another aspect, the invention provides kits comprising, in a container, a compound described herein and instructions for use. In some aspects, the kits also include a negative control, such as saline solution with phosphate buffer or a compound that does not recognize an intronic REMS, in a separate container. Examples
[00502] [00502] To describe in more detail and as an aid to the understanding of the present description, the following non-limiting biological examples are offered to illustrate more fully the scope of the description, which should not be interpreted specifically as limitations on the scope of the description. It is considered that the variations of this description that may not be known in the present or that will be developed in the future, whose determination would be up to the technician in the subject, fall within the scope of this description and as claimed below. The example below illustrates the existence of an intronic splicing modifier (REMS) recognition element that is important for the recognition of a compound described here, and the binding of such compound to intronic REMS in a precursor RNA allows or improves splicing of the Precursor RNA, and suggests the utility of intronic REMS in combination with a compound described here to modify RNA splicing and to modulate the amount of a gene product.
[00503] [00503] Cell treatment: GMO4856 lymphocyte cells were diluted in a medium composed of DMEM, 10% FBS and 1x Pen / Strep to a concentration of 2.5º cells / mL. 2 mL (500K cells) were seeded in 6-well plates and recovered for 4h at 37 ºC, 5% CO7. Dilutions of the compound in stock of 2x compound in medium were prepared (eg, for final concentration of 100 nM, prepare a stock at 200 nM). After 4h recovery, 2 ml of the stock with 2x compound was added to each well, resulting in 4 ml / well with a final concentration of lx compound. The cells were incubated for -20h at 37 ºC, 5% CO7r. After incubating, the cells were centrifuged for 5 minutes at 1000 rpm. The supernatant was removed in vacuo and the cells were resuspended in 350 upL of RLT buffer (with beta-mercapto-ethanol 10 pL / mL, RNeasy kit). Total RNA was isolated with the Qiagen RNeasy Mini Kit according to the manufacturer's instructions. The resulting total RNA concentration was determined using Nanodrop and diluted with water to a final concentration of 25 ng / upL.
[00504] [00504] End-point RT-PCR and RNAseq: Analysis of alternative splicing mRNAs in cultured cells
[00505] [00505] SH-SY5Y cells derived from a bone marrow biopsy of a female patient with neuroblastoma were seeded in a plate, 600,000 cells / well, in 2 mL of DMEM with 10% FBS in 6-well plates, and incubated by 4 hours in a cell culture incubator (37 ºC, 5% CO7z, 100% relative humidity). The cells were then treated with Compound 64 in different concentrations (in 0.1% DMSO) for 24 hours. After the supernatant was removed, the cells were lysed in RLT buffer with B-mercaptoethanol and the total RNA was extracted according to the manufacturer's protocol (RNeasy Mini Kit, Qiagen, Inc.).
[00506] [00506] "One-Step RT-PCR was performed using AgPath-ID" One-Step RT-PCR reagents (Life Technologies, Inc.) with 50 ng total input RNA. The following conditions were used for PCR: Step 1: 48 ºC (15 minutes), Stage 2: 95 ºC (10 minutes), Stage 3: 95 ºC (30 seconds), Stage 4: 55 ºC (30 seconds), Stage 5: 68 ºC (1 minute), repeat Steps 3 to 5 for 34 cycles, then maintain at 4 C. The presence of iExons within alternative splicing mRNAs was identified using the primers listed in Tables 13 to 19, which correspond to Figures 2, 3, 4 and 5. The PCR products were separated into 2% agarose E-gels (Life Technologies, Inc.), stained with ethidium bromide and visualized with an image capture system (Gel imager, UVP) .The results for genes affected by intronic exons generated by treatment with Compound 64 are shown in Table 21 and Table 22, for SH-SY5Y cells treated with Compound 64 at 24 nm and 100 nm, respectively, and in Table 2 3 for HD-1994 cells treated with Compound 64 at 100 nm.
[00507] [00507] For RNAsegq, SH-SY5Y cells were treated as described above. Total RNA (3 µg) was used for preparing a library and sequencing RNA strands. The mRNA was enriched with oligo microspheres (dT) and then randomly fragmented by the addition of fragmentation buffer, then the CcDNA was synthesized using the mRNA template and random hex primer primers, after that, a second custom synthesis buffer strand (Illumina), dNTPs, RNase H and DNA polymerase I were added to initiate the synthesis of the second strand. After several terminal repairs, ligation and ligation with adapter sequencing, the double-stranded cDNA library was completed through size selection and PCR enrichment. The RNA libraries were sequenced in a HiSeq sequencer at> 30M per sample, so final readings of 150 nt pairs were generated. The readings containing the sequence adapter were removed, and the other readings were mapped against the human genome (hgl9) using the STAR (version 2.5.1). Only single mapping readings (with MAPQ> 10) showing <5nt / 100nt pairing errors and properly matched readings were used. The number of readings in the coding sequence (CDS) region of protein coding genes and in the exonic region of non-coding genes were counted and analyzed by DESeg2 (Love et al., 2014). For the splicing analysis, readings were counted for different annotated or unnotated exons, but identified by RNA-seq. For each exon, the Percent-Spliced-In (PSI) value was calculated using the percentage of the average number of readings to support the inclusion of the exon among all readings supporting the inclusion or exclusion of an exon. Differences in PSI between two samples were compared and Fisher's Exact Test was used to determine statistical significance. Increase in PSI> 5% and P value <0.01 were used to select statistically significant intronic exons being included by the compound.
[00508] [00508] “Results: Oligonucleotides corresponding to exons that flank the intron where an iExon is located were used to amplify the total purified RNA from untreated cells (DMSO) or treated with Compound 64 (in the 10 nM, 1 dose range) puM or 10 pM).
[00509] [00509] The resulting products were run on an agarose gel where the resulting bands of interest for each gene are shown by light and dark arrowheads, where a light arrowhead represents an exon isoform in the occurrence of endogenous wild-type splicing ; and, where a dark arrowhead represents an exon isoform with iExon included in the MRNA, as shown in Figures 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B and 6A. In all cases, the increase in the concentration of the compound resulted in the appearance of a PCR product with slower migration containing the derived intronic exon, where the additional bands seen are intermediate products of splicing. The asterisk (*) in each Figure represents an event in which the targeted exon has been omitted (skipped).
[00510] [00510] Table 13. Primers forward to Figure 2
[00511] [00511] Table 14. Reverse primers for Figure 2
[00512] [00512] Table 15. Primers forward to Figure 3
[00513] [00513] Table 16. Primers reverse for Figure 3
[00514] [00514] Table 17. Primers forward for Figure 4 NO: ACCAACGTTTCTCAC
[00515] [00515] Table 18. Primers reverse for Figure 4
[00516] [00516] Table 19. Primers forward to Figure 5
[00517] [00517] Table 20 - primers for Figure 5
[00518] [00518] Results: RNA-sec data for iExon production (APSIT) according to Fisher's Exact Test (FET) in SH-SY5Y cells treated with Compound 64 at 24 nM (Table 21) and 100 nM ( Table 22) and in cells of the HD-1994 strain of normal human fibroblasts treated with Compound 64 at 100 nM (Table 23), provide the relative expression in Log2 of the gene expression (Log2FC) for each, where NA represents “Not available ”. Analysis of RNA-seq data in HD1994 cells obtained from Palacino, et al., (Nat. Chem. Bio., 2015, (11) 511-517; NCBI-SRA accession number SRPOS5454).
[00519] [00519] APSI for modulated expression of identified RNA transcripts is represented by stars in Table 21, Table 22 and Table 23, where one star (*) represents <25% variation in expression, two stars (**) represent variation in expression in a range of> 25% to <50% variation, three stars (***) represent variation in expression in a range of> 50% to <75% variation and four stars (****) represent variation in expression in a range of> 75% to <100% variation.
[00520] [00520] Table 21. Effect of compound at 24 nm on SHSY5Y cells inclusion [mes Ba | O as o [Roms [o [3 es o [as [e [E oa oo [Rare [O [E and [Bar [ Om [O Gas [oo [Bm ae [What if | oo [our [ro [O [Gen | oo [am [us [E and o [me [O [e ea | oo [Read [ms [es o
[00521] [00521] Table 22. Effect of the compound at 100 nm in SHSY5Y cells inclusion Fo Ts dr re ao [Gomes | Bo rsrs [o [ms [ro [or 22 To [man [ne | [oe [06 [o TO emos To [aa | as e sro [o [e TI O oro Lone a O si [o as E oe inclusion [me [us [Os [O osa | the [am Cn [and eoea | 00 [am [as [on | oo [ma [so [O [Gas | oo [mea | o [| [Omss | 6 [Lam CE e eo Lona | oo [and Os [emo | os [and Tas nar | oe [me Os e [os | o [Ba Os e eo [o [ra | Bo [| [emo | oo inclusion [Gm [OR [O in | oo [Lan OR Ta eo [me ss | [us | oo [an [us es [Gonos | o [ez Rr [e [nes | oo [are | [es [os | 00 [me o and roses [oo [ese e [12 | 00 inclusion [a [OR [A os | oo [Hunger [| [ninth | o [Ea [O [oem | o [LR a e [roses [o oa [Os and oa [so Os and os o [Gee and [noso [o [Oss Be DE O and inclusion [Ga [On [O nos | oo [Ga O [and [esa | 6 Logs TR O o [OG a [O ronaes | 00 [eso RB [O O om [o [mea | a [eos [0,0 [omecmeesza | mo [| [roms [| oo [a [Mr [Goes | oo [rings ho [eos [oo inclusion [o ns [o o as [um [rr es [o [seas | The om To
[00522] [00522] Table 23. Effect of 100 nM compound in HD-1994 cells [ar a [een [a [ne e O [ros [oe [ass As E cmo Too [aa [in [o Lo An o [Rm TO re ee
[00523] [00523] Details on the location of the iExon produced in affected genes from Table 21, Table 22 and Table 23 are shown in Table 24.
[00524] [00524] Table 24. Coordinates of the Coorinated genes (ngm) ABHD1 O echr3: +: 111709547; NM 018394 Containing domain 10 of 111709598 abhidrolase ADAL chrl15: +: 43629554: NM 001159280 | Similar to adenosine 43629613 deaminase ADAM17 chr2: -: 9683889: NM 003183 Domain 17 of ADAM 9683825 metallopeptidase ADAM23 chr2: +: 207470514: NM 003812 Domain 23 of ADAM 207470604 metallopeptidase ADAM23 chr2: +23 20747268282 ADAMTS19 chr5: +: 129023788: NM 133638 ADAM metallopeptidase with 129023907 motif thrombospondin type 1, 19 ADAMTS19 chr5: +: 128959360: NM 133638 ADAM metallopeptidase with 128959434 motif thrombospondin type 1, 19 AGPATA4 chr332: 16: 16 -3-phosphate 161687740 O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) AGPS chr2: +: 178297714; NM 003659 alkylglycerone phosphate 178297852 AKAP8L synthase chrl19: -: 15524082: NR 111971 Similar to protein 8 15523995 kinase The anchor (PRKA) AKT1 chrl14: -: 105261053: | NM 001014432 | Oncogene 1 homologue v- 105260902 akt of murine viral thymoma ANKRD13C ehrl: -: 70767766: NM 030816 Repeat domain 13C 70767706 of anquirina ANXA1l1 chr10: -: 81916254: NM 001278407 81916134 annexine All
[00525] [00525] The sequences for iExons produced in certain affected genes at the coordinates indicated in Table 24 are shown in Table 25. In certain cases, the detection and analysis of the quantity and type of iExon sequences are useful biomarkers produced as a result of placing a cell in contact with a compound as described herein or to administer to a subject in need of a compound as described herein.
[00526] [00526] Table 25. Sequences of genes to SEQ ID | eme PO second RP ABHD10 GACTCTGGAAGGAAAAACTATATTTCTTTACATTCAGCCTA 3808
[00527] [00527] Results: For certain genes, when the values for modifying the splicing could be considered statistically insignificant, the values in these cases led to manual examination of the RNAseq data for the probability of inclusion in the iExon production. Those events that demonstrated qualitative readings in support of the inclusion of iExon were subsequently validated by endpoint PCR. As demonstrated at present, the presence of an iExon has been demonstrated and validated for numerous targets.
[00528] [00528] It will be recognized that, although specific aspects of the invention have been described for purposes of illustration, the described invention is not limited in scope by the specific aspects set out herein. These aspects are intended to illustrate various aspects of the invention. Any equivalent aspects are intended to fall within the scope of this invention. In fact, various modifications of the invention in addition to those shown and described will become apparent to those skilled in the art from the above description, these modifications are also intended to fall within the scope of this invention.
[00529] [00529] All references cited are incorporated herein, in their entirety, by reference in this patent application and for all purposes to the same extent that they would be the case if each publication or patent or patent application had been specifically and individually indicated to be incorporated in its entirety by reference for all purposes.

权利要求:
Claims (5)
[1]
1. Method for modifying RNA splicing in order to produce a mature mRNA transcript having an exon, characterized by the fact that the method comprises putting a pre-mRNA transcript in contact with a compound of Formula (1) or a form of the same, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises in the order of 5 'to 3 ": a first 5 'splice site, a first branch point, a first 3 splice site", an intronic splicing modifier recognition element (iREMS), a second branch point and a second 3' splice site , where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, and where Formula (1) is: W. ços N — N (1) or a form thereof, in that: W is CH = CH or S; xXx is CHo, CH (Cisalkyl), C (Ciaalkyl), ', CH = CH, O, NRs or a bond; A is aryl, heteroaryl, heterocyclyl or Ca-10cycloalkyl, where aryl is selected from phenyl and naphthyl, each optionally substituted with 1, 2, 3 or 4 substituents, each selected from Ri,
where heteroaryl is a saturated monocyclic, bicyclic or tricyclic ring system with 1, 2 or 3 hetero atoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or substituents, each selected from R1,
where heterocyclyl is a monocyclic, bicyclic or tricyclic ring system saturated or partially unsaturated with 1, 2 or 3 hetero atoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3 , 4 or 5 substituents, each selected from Ra, and where Co-10ocycloalkyl is a saturated or partially unsaturated bicyclic ring system optionally substituted with 1, 2, 3, 4 or 5 substituents, each selected from Ro;
B is heterocyclyl,
where heterocyclyl is a monocyclic, bicyclic or polycyclic ring system saturated or partially unsaturated with 1, 2 or 3 hetero atoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3 , 4 or 5 substituents, each selected from Ra;
Ri is halogen, hydroxyl, cyano, Cyalkyl, halo-Ci-asalkyl, amino, Ci-aalkyl-amino, (Ci-caalkyl); - Amino, amino-Ci-akyl, Ci-salkyl-amino-Ci-salkyl, ( Ci-aalkyl),; - amino- Ci-aalkyl, amino-carbonyl, Ci-aalkyl-amino-carbonyl, (Ci-aalkyl),> - amino-carbonyl, Ci-aalkyl-amino-carbonyl- Ci-aalkyl, ( Cisalkyl),; - amino-carbonyl-C1-alkyl, Cisalkyl-carbonyl-amino, C1-salkyl-carbonyl-amino-C1-salkyl, hydroxyl-
Ci-aalkyl, Cyalkyl-carbonyl, Cyroalkoxy, halo-Cyroalkoxy, amino-Ci-, alkoxy, hydroxyl-Ci-salcoxy, Ci-aalkyl-Ci-aalkoxy, Ci-aalkyl-amino-Ci-aalkoxy, (Ci-aalkyl) , .- amino-Ci-salcoxy, Ci-aalkyl-carbonyl-amino-Ci-aalkoxy, Cisalcoxy-Cisalcoxy, Ci-aalkoxy-carbonyl, Ci-aalkoxy-carbonyl-amino, Ci-salcoxyl-carbonyl-amino-Ci-salcoxy , Cr-alkenyl, Car-1salkenyl-amino-carbonyl, C3-cycloalkyl, C3-icicloalkyl-Ci-salcoxy, C3-icicloalkenyl, heteroaryl, heteroaryl-Cisalkyl, heteroaryl-Ci-salkyl-amino, heteroaryl-Ci-heteroaryl-Ci -carbonyl, heteroaryl-C1-salkyl-carbonyl-amino, heteroaryl-C1-salkyl-amino-carbonyl-C1-alkyl, heteroaryl-C1-salkyl-carbonyl-amino-C1-alkyl, heterocyclyl, heterocyclyl-C1-salkyl, heterocyclyl -Ci-'alkoxy, phenyl or phenyl-Cialcoxy,
where heteroaryl is a monocyclic or bicyclic ring system saturated with 1, 2 or 3 heteroatoms as ring members, selected from N, O and S,
where heterocyclyl is a monocyclic or bicyclic ring system saturated or partially unsaturated with 1, 2 or 3 heteroatoms as ring members, selected from N, oOes, and where each case of phenyl, heteroaryl or heterocyclyl is optionally substituted with 1 or 2 substituents, each selected from R3;
R2 is halogen, hydroxyl, cyano, oxo, hydroxylimino, Ci-aalkyl, halo-Ci-aalkyl, amino, Ci-aalkyl-amino, (Ci-aalkyl) 7; -amino, amino-Ci-salkyl, Ci- aalkyl-amino-Ci-aalkyl, (Ci-salkyl),; - amino-Ci-salkyl, amino-carbonyl, hydroxyl-Ci-aalkyl, Ci-salcoxy, Ciaalkoxy-carbonyl, Cr-aalkenyl, C3-; cycloalkyl or heterocyclyl -Ciaalkyl,
where heterocyclyl is a monocyclic or bicyclic ring system saturated or partially unsaturated with 1, 2 or 3 heteroatoms as ring members, selected from N, oOes, and where each case of heterocyclyl is optionally substituted with 1 or 2 substituents , each selected from R3;
R; is halogen, hydroxyl, nitro, oxo, hydroxylimino, Ci-salquila, halo-Ci-salquila, amino, Ci-aalkyl-amino, (Ci-aalkyl) 2-amino, amino-Ci-aalkyl, Ci-aalkyl- amino- Ci-salquila, (Ci-salquil) 2> -amino-Ci-salquila, amino-carbonyl, Ci-aalkyl-amino-carbonyl, (Ci-salquyl) 2-amino-carbonyl, Ci-aalkyl-amino-carbonyl -Ci-salkyl, (C 1 -alkyl) 7; -amino-carbonyl-C 1 -alkyl, C 1 -alkyl-carbonyl-amino, C 1 -alkyl-carbonyl-amino-C 1 -alkyl, hydroxyl-C 1 -alkyl, Cisalkyl-carbonyl , C1-alkoxy, halo-C1-saloxy, amino-C1-salcoxy, hydroxyl-C1-alkoxy, C1-salkyl-C1-alkoxy, C1-alkyl-amino-Ciaalkoxy, (C1-alkyl), .- amino-C1 -aalkoxy, Ci-aalkyl-carbonyl-amino-Ci-a-alkoxy, Ci-salcoxy-Cisalcoxy, Cisalcoxy-carbonyl, Ci-aalkoxy-carbonyl-amino, Ci-aalkoxy-carbonyl-amino-Ci-salcoxy, C2r-aalkenyl, C2 -aen kenyl-amino-carbonyl, C3-cycloalkyl, C3a-icicloalkyl-C1-saloxy, C3-icicloalkenyl, heteroaryl, heteroaryl-C1-salkyl, heteroaryl-Cisalkyl-amino, heteroaryl-C1-aalkyl-amino-carbonyl a, heteroaryl-C 1 -alkyl-carbonyl-amino, heteroaryl-C 1 -alkyl-amino-carbonyl-C 1 -alkyl, heteroaryl-C 1 -alkyl-carbonyl-amino-C 1 -alkyl, heterocyclyl, heterocyclyl-C 1 -alkyl, phenyl or phenyl-C 1 -alkoxy;
Ra is independently selected from halogen, Ci-aalkyl, hydroxyl-Ci-aalkyl, amino, Ci-akyl-amino, (Ci-akyl),; - amino or hydroxyl-Ciaalkyl-amino; and Rs is hydrogen, Ci4salquila or hydroxyl-Ciasalquila; in which a form of the compound is selected from the group consisting of a form of prodrug, salt, hydrate, solvate, clathrate, isotopologist, racemate, enantiomer, diastereoisomer, stereoisomer, polymorph and tautomer thereof.
[2]
2. Method for modifying RNA splicing in order to modulate the amount of a mature mRNA transcript produced by a pre-mRNA transcript, characterized by the fact that the method comprises putting the pre-mRNA transcript in contact with a compound of Formula (I) or a form thereof, in which the pre-mRNA transcript comprises two exons and an intron, where a first exon is upstream of the intron and a second exon is downstream of the intron, where the intron comprises a sequence of RNA nucleotides including, on the order of 5 'to 3': an intronic splicing modifier (iREMS) recognition element, a branch point and a 3 'splice site, where iREMS comprises a sequence of RNA GAgurngn, where r is adenine or guanine and n is any nucleotide, and where Formula (1) is: ç N — N (1) or a form thereof, where: W is CH = CH or S;
xXx is CHo, CH (Cisalkyl), C (Cisalkyl) ,, CH = CH, O, NRs or a bond;
A is aryl, heteroaryl, heterocyclyl or Ca-10cycloalkyl,
where aryl is selected from phenyl and naphthyl, each optionally substituted with 1, 2, 3 or 4 substituents, each selected from Ri,
where heteroaryl is a saturated monocyclic, bicyclic or tricyclic ring system with 1, 2 or 3 hetero atoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3, 4 or substituents, each selected from R1,
where heterocyclyl is a monocyclic, bicyclic or tricyclic ring system saturated or partially unsaturated with 1, 2 or 3 hetero atoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3 , 4 or 5 substituents, each selected from R7, and where Cyclocycloalkyl is a saturated or partially unsaturated bicyclic ring system optionally substituted with 1, 2, 3, 4 or 5 substituents, each selected from Ro;
B is heterocyclyl,
where heterocyclyl is a monocyclic, bicyclic or polycyclic ring system saturated or partially unsaturated with 1, 2 or 3 hetero atoms as ring members, independently selected from N, O or S, each optionally substituted with 1, 2, 3 , 4 or 5 substituents, each selected from Ra;
Ri is halogen, hydroxyl, cyano, Cisalkyl, halo-Ci-aalkyl, amino, Ciaalkyl-amino, (Cisalkyl); - Amino, amino- Ci-akyl, Ci-salkyl-amino-Ci-salkyl, (Ci-aalkyl) , -amino- C1-alkyl, amino-carbonyl, C1-alkyl-amino-carbonyl, (C1-alkyl), -amino-carbonyl, C1-salkyl-amino-carbonyl-C1-alkyl, (Cisalkyl), - amino -carbonyl-Ci-salquila, Cisalquil-carbonyl-amino, Ci-salquyl-carbonyl-amino-Ci-salquila, hydroxyl- Ci-aalkyl, Cisalkyl-carbonyl, Ciraalkoxy, halo-Ci-raalkoxy, amino-Ci-aalkoxy, hydroxyl -Cisalcoxy, Ci-aalkyl-Cisalcoxy, Ci-aalkyl-amino-Ci-salcoxy, (Ci-salkyl) 2-amino-Ci-salcoxy, Ci-aalkyl-carbonyl-amino-Ci-salcoxi, Ci-aalkoxy-Ci- salcoxy, C1-alkoxy-carbonyl, C1-alkoxy-carbonyl-amino, C1-asalkoxy-carbonyl-amino-C1-alkoxy, Cr-1alkenyl, Cr-aalkenyl-amino-carbonyl, C3a-cycloalkyl, C3a-ircycloalkyl-Ci- salcoxy, C3-icycloalkenyl, heteroaryl, heteroaryl-Ci-salkyl, heteroaryl-Ci-aalkyl-amino, heteroaryl-Ci-salkyl-amino-carbonyl, heteroaryl-Ci-aa alkyl-carbonyl-amino, heteroaryl-Ci-aalkyl-amino-carbonyl-Ci-aalkyl, heteroaryl-Ci-salkyl-carbonyl-amino-Ci-salkyl, heterocyclyl, heterocyclyl-Ci-aalkyl, heterocyclyl-Ci-salcoxy, phenyl or phenyl-Ciasalcoxy,
where heteroaryl is a monocyclic or bicyclic ring system saturated with 1, 2 or 3 heteroatoms as ring members, selected from N, O and S,
where heterocyclyl is a monocyclic or bicyclic ring system saturated or partially unsaturated with 1, 2 or 3 heteroatoms as ring members, selected from N, oOes, and where each case of phenyl, heteroaryl or heterocyclyl is optionally substituted with 1 or 2 substituents, each selected from R3;
R2 is halogen, hydroxyl, cyano, oxo, hydroxylimino, Ci-aalkyl, halo-Ci-salkyl, amino, Ci-aalkyl-amino, (Ci-aalkyl) 2z-amino, amino-Ci-salkyl, Ci-aalkyl -amino- Ci-salquila, (Ci-salquil) 2-amino-Ci-salquila, amino-carbonyl, hydroxyl-Cisalquila, Cisalcoxy, Cisalcoxy-carbonyl, C2-2alkenyl, C3-; cycloalkyl or heterocyclyl-Cisalkyl,
where heterocyclyl is a saturated or partially unsaturated monocyclic or bicyclic ring system with 1, 2 or 3 heteroatoms as ring members, selected from N, oes, and where each case of heterocyclyl is optionally substituted with 1 or 2 substituents , each selected from R3;
R; is halogen, hydroxyl, nitro, oxo, hydroxylimino, Ci-aalkyl, halo-Ci-salkyl, amino, Ci-aalkyl-amino, (Ci-aalkyl) 2: -amino, amino-Ci-salkyl, Ci-aalkyl -amino- Ci-salquila, (Ci-salquil) 2: -amino-Ci-salquila, amino-carbonyl, Ci-aalkyl-amino-carbonyl, (Ci-salquyl) 2-amino-carbonyl, Ci-aalkyl-amino- carbonyl-Ci-salquila, (Ci-aalkyl)> - amino-carbonyl-Ci-salquila, Ci-salkyl-carbonyl-amino, Ci-salkyl-carbonyl-amino-Ci-aalkyl, hydroxyl-Cisalkyl, Ci-salkyl-carbonyl , C1-alkoxy, halo-C1-alkoxy, amino-C1-saloxy, hydroxyl-Cisalcoxy, C1-salkyl-C1-salcoxy, C1-asalkyl-amino-C1-alkoxy, (C1-alkyl),> - amino-C1 -salcoxy, C1-alkylalkyl-carbonyl-amino-C1-saloxy, C1-alkoxy-C1-saloxy, C1-alkoxy-carbonyl, C1-alkoxy-carbonyl-amino, C1-alkoxy-carbonyl-amino-C1-salcoxy,
Cr-aalkenyl, Cr-aalenyl-amino-carbonyl, C3a-cycloalkyl, C3a-cycloalkyl-Ci-salcoxy, C3-cycloalkenyl, heteroaryl, heteroaryl-Ci-aalkyl, heteroaryl-Ci-salkyl-amino, heteroaryl -amino-carbonyl, heteroaryl-C 1 -alkyl-carbonyl-amino, heteroaryl-C 1 -alkyl-amino-carbonyl-C 1 -alkyl, heteroaryl- C 1 -alkyl-carbonyl-amino-C 1 -alkyl, heterocyclyl, heterocyclyl-Cisalkyl, phenyl or phenyl-C 1 -alkoxy; Ra It is independently selected from halogen, Ci-salquila, hydroxyl-Cisalquila, amino, Ci-aalkyl-amino, (Ci-aalkyl) 2-amino or hydroxyl-Ci-salkyl-amino; and Rs is hydrogen, Ci-akyl or hydroxyl-Cisalkyl; in which a form of the compound is selected from the group consisting of a form of prodrug, salt, hydrate, solvate, clathrate, isotopologist, racemate, enantiomer, diastereoisomer, stereoisomer, polymorph and tautomer thereof.
[3]
Method according to claim 1 or 2, characterized in that the iREMS comprises a sequence of RAG GAguragu and in which r is adenine or guanine.
[4]
Method according to claim 1 or 2, characterized in that p iREMS comprises an NNGAgurngn RNA sequence (SEQ ID NO: 1), where r is adenine or guanine and nisN any nucleotide, and in which the sequence of RNA NNGAgurngn (SEQ ID NO: 1) is selected from the group consisting of ANGAgurngn (SEQ ID NO: 4), CNGAgurngn (SEQ ID NO: 5), GNGAgurngn (SEQ ID NO: 6), UNGAgurngn (SEQ ID NO: 6) : 7), NAGAgurngn (SEQ ID NO: 8), NCGAgurngn (SEQ ID NO: 9), NGGAgurngn
(SEQ ID NO: 10), NUGAgurngn (SEQ ID NO: 11), AAGAgurngn (SEQ ID NO: 12), ACGAgurngn (SEQ ID NO: 13), AGGAgurngn (SEQ ID NO: 14), AUGAgurngn (SEQ ID NO: 15), CAGAgurngn (SEQ ID NO: 16), CCGAgurngn (SEQ ID NO: 17), CGGAgurngn (SEQ ID NO: 18), CUGAgurngn (SEQ ID NO: 19), GAGAgurngn (SEQ ID NO: 20), GCGAgurngn ( SEQ ID NO: 21), GGGAgurngn (SEQ ID NO: 22), GUGAgurngn (SEQ ID NO: 23), UAGAgurngn (SEQ ID NO: 24), UCGAgurngn (SEQ ID NO: 25), UGGAgurngn (SEQ ID NO: 52) ), and UUGAgurngn (SEQ ID NO: 53), where r is adenine or guanine en or N is any nucleotide.
[5]
5. Method according to claim 1 or 2, characterized in that the iREMS comprises an NNGAguragu RNA sequence (SEQ ID NO: 2), where r is adenine or guanine and N is any nucleotide, and where the NNGAguragu RNA sequence (SEQ ID NO: 2) is selected from the group consisting of ANGAguragu (SEQ ID NO: 28), CNGAguragu (SEQ ID NO: 29), GNGAguragu (SEQ ID NO: 30), UNGAguragu (SEQ ID NO: 31) NAGAguragu (SEQ ID NO: 32), NCGAguragu (SEQ ID NO: 33), NGGAguragu (SEQ ID NO: 34), NUGAguragu (SEQ ID NO: 35), AAGAguragu (SEQ ID NO: 36), ACGAguragu (SEQ ID NO: 37), AGGAguragu (SEQ ID NO: 38), AUGAguragu (SEQ ID NO: 39), CAGAguragu (SEQ ID NO: 40), CCGAguragu (SEQ ID NO: 41) cGGAguragu (SEQ ID NO: 42), CUGAguragu (SEQ ID NO: 43), GAGAguragu (SEQ ID NO: 44), GCGAguragu (SEQ ID NO: 45), GGGAguragu (SEQ ID NO: 46), GUGAguragu (SEQ ID NO: 47), UAGAguragu ( SEQ ID NO: 48), UCGAguragu (SEQ ID NO: 149), UGGAguragu (SEQ ID NO: 489) and UUGAguragu (SEQ ID NO: 508), where r is adenine the u guanine and N is any nucleotide.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112019026508A2|2020-07-14|methods for modifying rna splicing

---

AU2020200699B2|2021-03-25|Methods and compositions for modulating splicing

---

JP2016538342A|2016-12-08|Compositions and methods using transposons

---

US20190330615A1|2019-10-31|Methods for modulating rna splicing

---

JP2020534826A|2020-12-03|Modification of specificity of non-coding RNA molecules for silencing gene expression in eukaryotic cells

---

WO2019084271A1|2019-05-02|Papd5 inhibitors and methods of use thereof

---

CN114007614A|2022-02-01|Methods and compositions for modulating splicing

---

CN114007612A|2022-02-01|Methods and compositions for modulating splicing

---

CN114007613A|2022-02-01|Methods and compositions for modulating splicing

---

KR20210135507A|2021-11-15|Methods and compositions for controlling splicing

---

US20210330678A1|2021-10-28|Papd5 inhibitors and methods of use thereof

---

KR20210151823A|2021-12-14|Compositions and methods for correcting abnormal splicing

---

CN113661162A|2021-11-16|Methods and compositions for modulating splicing

---

KR20210135243A|2021-11-12|Methods and compositions for controlling splicing

---

CN113660936A|2021-11-16|Methods and compositions for modulating splicing

---

KR20210123344A|2021-10-13|Methods and compositions for controlling splicing

---

US11129829B2|2021-09-28|Methods for modulating splicing

---

Mahpour2018|The Role of the CGCG Element in the Human Genome

---

WO2020159349A4|2021-03-04|Antisense oligonucleotides of glutathione s transferases gstm3 and/or gstp1 for treating cancer

同族专利:

---

公开号 | 公开日

---

CN111372611A|2020-07-03|

---

KR20200017476A|2020-02-18|

---

IL271053D0|2020-01-30|

---

US20200370043A1|2020-11-26|

---

EP3638318A1|2020-04-22|

---

AU2018284853A1|2019-12-19|

---

EP3638318A4|2021-03-17|

---

CA3065547A1|2018-12-20|

---

WO2018232039A1|2018-12-20|

---

EA202090034A1|2020-04-16|

---

JP2020523365A|2020-08-06|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

EP3256126A1|2015-02-09|2017-12-20|F. Hoffmann-La Roche AG|Compounds for the treatment of cancer|

---

EP3310169A4|2015-05-30|2018-12-12|PTC Therapeutics, Inc.|Methods for modulating rna splicing|EP3310169A4|2015-05-30|2018-12-12|PTC Therapeutics, Inc.|Methods for modulating rna splicing|

---

EP3689863A1|2017-08-04|2020-08-05|Skyhawk Therapeutics, Inc.|Methods and compositions for modulating splicing|

---

KR20220008887A|2019-05-17|2022-01-21|노파르티스 아게|NLRP3 inflammasome inhibitor|

---

WO2020248018A1|2019-06-14|2020-12-17|Children's Medical Research Institute|Methods of treating cancer with an inhibitor of znf827|

---

US11129829B2|2019-06-17|2021-09-28|Skyhawk Therapeutics, Inc.|Methods for modulating splicing|

---

TW202131920A|2019-11-01|2021-09-01|瑞士商諾華公司|The use of a splicing modulator for a treatment slowing progression of huntington’s disease|

---

WO2021126779A1|2019-12-18|2021-06-24|The Regents Of The University Of California|Inhibitors of lin28 and methods of use thereof|

---

WO2021138678A1|2020-01-02|2021-07-08|The General Hospital Corporation|Rna splicing modulation|

---

WO2021174165A1|2020-02-28|2021-09-02|Remix Therapeutics Inc.|Heterocyclic amides and their use for modulating splicing|

---

WO2021174167A1|2020-02-28|2021-09-02|Remix Therapeutics Inc.|Compounds and methods for modulating splicing|

---

WO2021174174A1|2020-02-28|2021-09-02|Remix Therapeutics Inc.|Thiophenyl derivatives useful for modulating nucleic acid splicing|

---

WO2021174176A1|2020-02-28|2021-09-02|Remix Therapeutics Inc.|Pyridazine dervatives for modulating nucleic acid splicing|

---

WO2021207530A1|2020-04-08|2021-10-14|Remix Therapeutics Inc.|Compounds and methods for modulating splicing|

---

WO2021207532A1|2020-04-08|2021-10-14|Remix Therapeutics Inc.|Compounds and methods for modulating splicing|

---

WO2021247856A2|2020-06-03|2021-12-09|The Trustees Of Columbia University In The City Of New York|Compositions and methods for inhibition of lineage specific antigens using crispr-based base editor systems|

---

WO2022006550A1|2020-07-02|2022-01-06|Remix Therapeutics Inc.|2--6--1,7-naphthyridine derivatives and related compounds as modulators for splicing nucleic acids and for the treatment of proliferative diseases|

---

WO2022006543A1|2020-07-02|2022-01-06|Remix Therapeutics Inc.|5-[5-thieno[3,2-c]pyrazol-2-yl]indazole derivatives and related compounds as modulators for splicing nucleic acids and for the treatment of proliferative diseases|

法律状态:
2021-11-03| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762519226P| true| 2017-06-14|2017-06-14|

---

US62/519,226|2017-06-14|

---

PCT/US2018/037412|WO2018232039A1|2017-06-14|2018-06-13|Methods for modifying rna splicing|

---